MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)

Lecture 1
1. What is the primary mutation-repair mechanism? Polymerase proofreading
2. Name one way to repair a double stranded break NHEJ, homologous recombination
3. What could happen to your DNA if you dont wear sunscreen? mutations, UV damage
4. What is a pseudogene? A region of genomic DNA that is similar in structure to a gene
but is non-functional
5. If an individual carries a particular mutation in its lungs but not in any other tissues, is it a
somatic or germline mutation? somatic
in sperm/eggs? germline
6. High-energy radiation can cause double strand breaks (DSBs) in DNA. Name two
mechanisms that repair these mutations. HR, NHEJ
7. NHEJ and HR are the major pathways for double strand break repair. Why is HR
considered a more accurate repair system than NHEJ? NHEJ joins the two strands
together non-specifically and sometimes there are insertions/deletions because of this
while HR uses the homologous DNA has a template to repair.
8. You found a hypermorphic mutation in Gene A, but the protein-coding region of the
mutant allele is same as that of wt allele. You reasoned that the phenotype could be
caused by a transposon insertion, so you sequenced the DNA around the gene, and
found there is, in fact, a transposon insertion around the gene A.
a. In which region did you probably find the transposon? [2points]
Gene expression regulatory regions, Promoter, or enhancer regions
b. What are the possible mechanisms by which this transposon insertion
caused this hypermorphic mutation? Write an example [2points]
TE might include enhancer, promoter or the protein coding region of gene A
itself; many answers possible but must be compatible with the answer to a)
Lecture 2
1. What is the difference between a conservative and nonconservative missense mutation?
The former changes an amino acid to one with similar chemical properties, while the
latter changes it to one with different properties
2. A point mutation that leads to an early stop codon is called what? nonsense
3. A point mutation that causes no change in the amino acid sequence of a protein is called
what? silent
4. Why do mutations in DNA that encode hydrophobic regions of proteins tend to have a
stronger effect than those that encode hydrophilic regions?
5. The same genetic mutation can result in (variable) phenotypes in different individuals.
What are the two terms that describe this? Incomplete penetrance, variable expressivity
6. If a doctor told you you had a silent point mutation in the protein coding region of an
important gene, would you worry? What if the doctor told you it was a nonsense
mutation? Why? No, because the amino acid sequence would be the same; yes,
because the protein would be short/truncated

MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)
7. If you have a population of rats where nearly all of them (have brown fur) are brownfurred, and only a couple (have white fur) are white-furred, which phenotype would you
guess is the wildtype phenotype? Why? Brown fur; many explanations possible
8. To explain expressivity and penetrance of a mutation, we review the tbx-9 mutant. tbx-9
individuals with high expression of daf-21 are normal whereas those with low expression
of daf-21 are abnormal. However, if you examine individual animals, youll find that some
abnormal individuals have the same level of expression of daf-21 as normal individuals.
How do you explain this phenomenon? Genetic background (other genes besides tbx-9
and daf-21), environmental conditions and stochastic events .
9. You find that you are heterozygous for a gene:
Allele A is transcribed and a part of the mRNA transcript is
AUGACUUGGCUGAGAACUUGAAAA
Allele A, which is a mutant allele, is also transcribed and the part of the mRNA transcript
including the mutation is
AUGACUUGGCUAAGAACUUGAAAA
(each sequence starts with the first letter of a codon)

a. Do you expect a mutant phenotype from this heterozygous gene? Answer

why or why not. [2points] No, it encodes the same (wt) protein (the changed
codon still encodes leucine)
b. What type of mutation is it called? [2points]
Silent mutation

Lecture 3:
1. Siamese cats have a temperature-sensitive tyrosinase mutation - what kind of allele is
this? conditional
2. Give two (one-two word) reasons why a mutation might have variable expressivity or
penetrance. environment, genetic background, stochastic events
3. Give two (one-two word) ways that a mutation could make a gene hypermorphic. copy
number inc, duplication, transcription inc, translation inc, protein activity inc.
4. p53 is a protein that helps prevent cancer through various mechanisms. Because of this,
(cancer cells from) many cancer patients have been found to have mutations in one of

MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)
their p53 alleles. These mutant p53 proteins have a (_dominant negative/antimorphic_)
effect on the wild-type p53 protein, by preventing wild-type p53 from binding to the
promoter of its target genes
5. Youre studying the function of an essential gene, using as model organism
Saccharomyces cerevisiae. The problem you have is fairly simple. If you make a null
mutant of your gene of interest the yeast wont grow. What would be your strategy to
eliminate the gene function while still being able to grow the cells? Conditional allele or
TS allele, which will allow your yeast to grow at permissive temperature, but there will be
no gene function at the restrictive temperature.
6. Among your population of puffskeins, you find a mutation you name fluffy. Wild-type
puffskeins have flat hair, but individuals with the fluffy mutation all have fluffy hair;
however, some have fluffier hair than others. Describe and explain the penetrance and
expressivity of this mutation. Complete penetrance (all individuals with the mutation
have a phenotype) and variable expressivity (the phenotype is variable)
7.

Snapdragon flowers come in three possible colors: Red, white, and pink, controlled by a
single color gene. Snapdragons with red flowers are homozygous for the R allele (R/R),
while snapdragons with white flowers are homozygous for the r allele (r/r).
a. What do you think is the genotype of the pink flowers color gene? [2points]
R,r
b. What is the effect that explains the pink color of the flower? [2points]
haploinsufficiency (or incomplete dominance/codominance)

Lecture 4:
1. If you find a mutant phenotype that only seems to appear in male mice, what kind of
mutation is it? sex-linked mutation
2. What are sister chromatids? A chromosome and its replicated copy
3. (___Meiosis___) is a specialized type of cell division which reduces the chromosome
number by half. This process occurs in all sexually reproducing eukaryotes (both singlecelled and multicellular) including animals, plants, and fungi

MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)
4. Label the indicated items on this image

5. Imagine youre doing Mendels experiments. You crossed two plants, one with Yellow
peas (which is a dominant mutation) and the other with Green peas (which is a recessive
mutation). If, after crossing them, half of the F1 progeny are green and the other half are
yellow, what was the genotype of the parents? If you plant two of the yellow pea from the
F1 progeny and cross them, what would be the genotypes of their F2 progeny? Parents
genotypes are heterozygous (Yy) and recessive homozygous (yy); progeny are
YY:Yy:yy in 1:2:1 ratio.
6. What kind of inheritance pattern is consistent with the disease in the pedigree below?
Why? (Note that circles are female, squares are male, and black shapes have the
disease phenotype while white shapes are wild-type.)

MCB 104 Quiz 1 combined answer key

(Different sections had different questions.)
[Different pedigrees for different sections, but same answer.] Autosomal recessive.
Various explanations possible.
7. Mendel crossed plants that are pure breeding for yellow peas with plants that are pure
breeding for green peas, got all yellow peas in F1, and got 3 yellow : 1 green ratio in F2.
a. Which phenotype is dominant and which one is recessive? [1point]Y(yellow) is
dominant
b. What are the genotypes of F1 and F2 progeny? [1points] F1=> all Yy // F2 =>
YY + 2Yy + yy
c. If he crosses among yellow peas that he got from F2, what would be the
ratio of Yellow : Green in F3? Explain why. [2 points]
8:1
(Yellow = 1-P(Green) = 1- (**1/4) = 8/9) or write a table
Lecture 5:
1. (__Nondisjunction__) is the failure of homologous chromosomes or sister chromatids to
separate properly during cell division. [1point]
2. X and Y chromosomes can pair with each other during meiosis because of their
(__Pseudoautosomal/homologous__) regions.
3. Aneuploidy of _____sex_______ chromosomes are okay, but aneuploidy of
_autosomal____ chromosomes are often fatal. (Name the types.)
4. Explain how aneuploidy occurs. nondisjunction, meiosis defect, fusion of the gametes
results in zygote with abnormal chromosome number
5. What was exceptional about Morgans white-eyed female, that allowed it to have a
small number of white-eyed female offspring and red-eyed sterile male offspring? It had
a meiosis defect that allowed nondisjunction of its X chromosomes to occur occasionally;
alternately, it was XXY, with an explanation of how it created its offspring
6. Explain what a trisomy is, and why nearly all of them are fatal in humans. 3 copies of
one chromosome; 50% extra gene product of an entire chromosomes worth of genes is
very bad
7. A woman happened to check her karyotype and was surprised to find that her sex
chromosomes were XY instead of XX. (a) Explain how this could be the case. (b) What
genetic mechanism might have caused the mutation you listed in a?
Probably her Y chromosome is the one without SRY, the sex determining gene.
As the expression of that gene is necessary for determining the maleness, she became
female even with XY (and also having only one X is enough to be a female - turner
syndrome). She probably lost the gene via recombination between the pseudoautosomal
regions on the X and Y chromosomes, or gene mutation (loss of function) in SRY etc.
Many possible answers.