ARTHRITIS & RHEUMATISM

Vol. 58, No. 2, February 2008, pp 511–520

DOI 10.1002/art.23306
© 2008, American College of Rheumatology

AUF1, the Regulator of Tumor Necrosis Factor ␣

Messenger RNA Decay, Is Targeted by Autoantibodies
of Patients With Systemic Rheumatic Diseases

Karl Skriner,1 Wolfgang Hueber,2 Erhan Süleymanoglu,3 Elisabeth Höfler,2 Veit Krenn,4
Josef Smolen,5 and Günter Steiner6

Objective. To investigate which members of the
heterogeneous nuclear RNP (hnRNP) family are tar-
geted by autoantibodies from patients with systemic
rheumatic diseases.
Methods. Using a semipurified preparation of
natural hnRNP proteins, 365 sera from patients with
rheumatic diseases and control subjects were screened
by immunoblotting for the presence of autoantibodies.
Bacterially expressed recombinant hnRNP D (AUF1)
proteins were used for confirming the data obtained.
Binding of RNA and autoantibody to AUF1 was inves-
tigated by gel retardation assays. Expression of AUF1 in
cultivated cells and synovial tissue was analyzed by
indirect immunofluorescence and immunohistochemis-
try.
Results. Autoantibodies to AUF1 proteins were
detected in 33% of patients with systemic lupus ery-
thematosus, 20% of patients with rheumatoid arthritis,
Supported by the Center for Molecular Medicine of the
Austrian Academy of Sciences, Vienna, the German Ministry of
Education and Research, the National Genome Research Network
(grants NGFN-2.SIPAGE and NIE-S02T28), and the European Union
AutoCure (grant 018661).
1
Karl Skriner, PhD: Charité University Medicine Berlin,
Humboldt University and Free University, Berlin, Germany, and
Medical University of Vienna, Vienna, Austria; 2Wolfgang Hueber,
MD (current address: Stanford University, Palo Alto, California),
Elisabeth Höfler, MTA: Hietzing Hospital, Vienna, Austria; 3Erhan
Süleymanoglu, PhD (current address: Gazi University, Ankara, Tur-
key): Institute of Medical Biochemistry and Medical University of
Vienna, Vienna, Austria; 4Veit Krenn, MD: Charité University Med-
icine Berlin, Humboldt University and Free University, Berlin, Ger-
many; 5Josef Smolen, MD: Medical University of Vienna, Hietzing
Hospital, and Ludwig Boltzmann Institute for Rheumatology and
Balneology, Vienna, Austria; 6Günter Steiner, PhD: Institute of Med-
ical Biochemistry, Medical University of Vienna, and Ludwig Boltz-
mann Institute for Rheumatology and Balneology, Vienna, Austria.
Address correspondence and reprint requests to Karl Skriner,
PhD, Charité University Medicine Berlin, Department of Rheumatol-
ogy and Clinical Immunology, Tucholskystrasse 2, 10117 Berlin, Ger-
many. E-mail: Karl.Skriner@charite.de.
Submitted for publication January 29, 2007; accepted in
revised form October 5, 2007.
511
17% of patients with mixed connective tissue disease,
and <10% of patients with other rheumatic disorders.
Epitope mapping studies showed the autoantibodies to
be directed to conformational epitopes in the
N-terminal RNA-binding part of AUF1. However, auto-
antibody binding did not interfere with RNA binding as
assessed by gel-shift assays. Immunohistochemical
studies revealed AUF1 to be expressed in the cytoplasm
of RA synovial tissue as compared with nuclear staining
in osteoarthritis and normal synovium, particularly in
macrophages of the lining layer and in fibroblasts of the
sublining areas.
Conclusion. These data identify AUF1 proteins as
novel autoantigens in SLE and related autoimmune
disorders. Because AUF1 proteins are major compo-
nents of messenger RNA stability complexes, our find-
ings suggest that these complexes form a novel macro-
molecular target structure for autoantibodies in
rheumatic autoimmune diseases.
Autoantibodies to intracellular antigens are a
distinguishing feature of autoimmune rheumatic dis-
eases such as systemic lupus erythematosus (SLE), pro-
gressive systemic sclerosis (SSc; scleroderma), polymyo-
sitis, mixed connective tissue disease (MCTD), or
rheumatoid arthritis (RA) (1). These autoantibodies are
typically directed to sets of proteins associated with
discrete supramolecular entities built up of either DNA
or RNA and proteins, such as the nucleosome, the
centromere, the spliceosome, the ribosome, or other
RNPs (2). Based on this observation, Tan and Hardin
(3,4) formulated the particle hypothesis of autoimmuni-
zation, which postulates that the autoimmunogenic rep-
ertoire of a given disease could be localized on a single
or a limited number of subcellular units, each of which is
an assembly of multiple noncovalently linked molecules.
In eukaryotic cells, protein-encoding genes are
512
transcribed by RNA polymerase II into large precursor
RNAs that are known as heterogeneous nuclear RNAs
or pre–messenger RNA (mRNA). During their entire
nuclear life, these RNAs are associated with a set of
proteins that have been termed heterogeneous nuclear
RNPs (hnRNP), thereby forming large complexes whose
composition may be specific for each mRNA (5). In
association with the small nuclear RNPs (snRNP) and
other protein factors, they form the spliceosome. Data
obtained in recent years have revealed that apart from
snRNP, several other splicesomal proteins are targeted
by patients with systemic autoimmune diseases. Interest-
ingly, although snRNP and certain splicing factors such
as serine/arginine-rich proteins appear to be targeted
mainly, if not exclusively, in patients with SLE or
MCTD, autoantibodies to hnRNP have also been ob-
served in patients with other rheumatic diseases, partic-
ularly RA (6,7). Thus, antibodies to hnRNP A2 (also
known as the RA33 antigen), as well as antibodies to the
closely related hnRNP A1, have been repeatedly found
in patients with RA and those with SLE, and antibodies
to hnRNP I have been described to occur especially in
patients with SSc (8,9). Apart from their established
roles in pre-mRNA splicing, hnRNP are involved in
cytoplasmic export of mature mRNA and in various
aspects of posttranscriptional regulation of gene expres-
sion, including translation and regulation of mRNA
stability (10).
The hnRNP D proteins are a subgroup of at least
4 proteins generated by alternative splicing, which are
also known as AUF1 (AU-rich element [ARE]–binding
factor 1) because they preferentially bind to adenine-
and uridine-rich sequences in the 3⬘–untranslated region
(3⬘-UTR) of short-lived mRNA such as c-fos or tumor
necrosis factor ␣ (TNF␣) mRNA (11). Binding of AUF1
leads to destabilization of the mRNA, resulting in their
rapid degradation by RNases (12). These proteins are
closely related to the hnRNP A/B proteins, showing a
similar general structure, i.e., 2 adjacent RNA recogni-
tion motives (RRMs), which are followed by a glycine-
rich C-terminal auxiliary domain (13). In this study, we
present strong evidence for the existence of such auto-
antibodies to AUF1 and demonstrate these antibodies
to be directed to the functionally important N-terminal
region of the protein.
PATIENTS AND METHODS
Patients. A total of 365 sera from patients with RA
(n ⫽ 101), SLE (n ⫽ 70), MCTD (n ⫽ 30), SSc (n ⫽ 44),
polymyositis/dermatomyositis (n ⫽ 17), primary Sjögren’s syn-
drome (n ⫽ 11), reactive arthritis (n ⫽ 31), psoriatic arthritis
SKRINER ET AL
(n ⫽ 10), and osteoarthritis (OA; n ⫽ 26), and healthy control
subjects (n ⫽ 25) were assessed. The sera were derived from
clinically and serologically well-characterized patients and
were obtained from the serum bank of the 2nd Department of
Medicine, Hietzing Hospital, with institutional ethics approval.
All patients with RA fulfilled the 1987 revised criteria of the
American College of Rheumatology (ACR; formerly, the
American Rheumatism Association) (14), all patients with
SLE met the 1982 criteria of the ACR (15), and all patients
with MCTD met the criteria described by Alarcon-Segovia and
Villareal (16).
Preparation of natural hnRNP proteins. To obtain a
semipurified preparation of hnRNP proteins, extracts were
prepared from HeLa nuclei and partially purified by heparin–
Sepharose chromatography, essentially as previously described
(17).
Oligonucleotides. Oligoribonucleotides and polymer-
ase chain reaction (PCR) primers were obtained from the
DNA synthesis and sequencing unit of the Vienna Biocenter.
The following PCR primers were used: for N10, GACGACG-
ACAAGATGGCGGCGGCAGCGGCAACGGCG; for N20,
GACGACGACAAGATGGGCGGCTCGGCGGGCGAG-
CAG; for Ct256, GACGACGACAAGATGGCCATGTCGA-
AGGAACAATAT; for Ct145, GAGGAGAAGCCCGGTT-
CAAAATAGCACAAAGCC; for N174, GAGGAGGAGA-
AGATGGCCATGAAAACAAAAGAGCCG; for Ct173,
GAGGAGAAGCCCGGTTCATTTGGCCCTTTTAGG-
TCT; for N63, GACGACGACAAGATGTCGGAGGGGGA-
CAAG-ATT; for Nt30, GACGACGACAAGATGGTGGCG-
GCGACACAGGG. For RNA binding studies, the oligoribo-
nucleotides (AUUUA)5 and AACUUGUGAUUAUUUAU-
UAUUUAUUUAUUAUUUAUUUAUUUA (derived from
the 3⬘-UTR of the TNF␣ mRNA) were used (18).
Cloning and expression of recombinant proteins. The
complementary DNA (cDNA) encoding the entire sequence
of AUF1 (a kind gift from Gary Brewer, School of Medicine,
Wake Forest University) and a series of deletion mutants
constructed by cloning of PCR fragments were cloned into
pET30 vectors (Novagen, Madison, WI) and expressed as
His-tagged fusion proteins, which were purified by Ni-chelate
affinity chromatography (Clontech, Palo Alto, CA). Purity was
⬃95% as analyzed by sodium dodecyl sulfate–polyacrylamide
gel electrophoresis (SDS-PAGE) and Coomassie protein stain-
ing. For RNA binding studies, fragments were cloned into the
pET-8c vector and expressed without a His tag. Non–His-
tagged proteins were purified by cation exchange chromatog-
raphy on CM Sepharose, as previously described (19). The
AUF1p45 cDNA was cloned into the pcDNA 3.1/NT-GFP-
TOPO vector (Invitrogen) and transfected into HeLa cells, as
previously described (11).
Gel electrophoresis and immunoblotting. Samples
were separated on 12% SDS minigels and transferred to
nitrocellulose membranes (BAS53; Schleicher & Schuell, Das-
sel, Germany), as previously described (18). After blocking the
nitrocellulose with blocking buffer (3% nonfat dried milk in
PBS, pH 7.4) for 60 minutes, the blots were incubated for 30
minutes with sera diluted between 1:25 and 1:100 in the same
buffer. The blots were washed 3 times for 5 minutes with PBS
containing 0.1% Triton X-100 (PBS–Triton) and subsequently
incubated for 30 minutes with an alkaline phosphatase–
coupled anti-human IgG (Fc) secondary antibody (Accurate,
AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS
Westbury, NY), as previously described. All steps were per-
formed at room temperature.
Immunoaffinity purification of antibodies. Autoanti-
bodies to AUF1 from 1 patient with RA and 2 patients with
SLE were affinity-purified by the blot elution technique, as
previously described (19). Autoantibodies to hnRNP A2 puri-
fied by the same method were used as controls. Briefly,
nitrocellulose strips containing the blotted antigens were incu-
bated overnight at 4°C with sera diluted 1:10 in blocking buffer,
washed thoroughly, cut into small pieces, and finally incubated
for 2 minutes with 0.1M Tris, pH 10.5. The eluate was
immediately neutralized with 1/10 volume of 1M Tris HCl, pH
6.8. Eluted antibodies were concentrated in Centricon-30 tubes
(Amicon, Danvers, MA) by centrifugation for 20 minutes at
5,000g. To estimate the yield, affinity-purified antibodies were
analyzed by SDS-PAGE and Coomassie blue staining, using
purified human IgG (Sigma, St. Louis, MO) as standard.
Finally, eluted antibodies (100 ng/ml) were analyzed by immuno-
blotting, using either nuclear extracts or purified AUF1 as
antigen.
Indirect immunofluorescence microscopy. Commer-
cial acetone-fixed HEp-2 cell slides (ANA HEp-2 slides;
Generic Assays, Dahlewitz, Germany) were used in immuno-
fluorescence studies. Slides were incubated with serum (di-
luted 1:200 in PBS) or affinity-purified anti-AUF1 antibody
(100 ng/ml in PBS) for 60 minutes at room temperature,
washed 3 times with PBS, and subsequently incubated for 30
minutes with fluorescein isothiocyanate–conjugated goat anti-
human IgG (Caltag, South San Francisco, CA).
Preparation of rabbit antibodies. AUF1-specific anti-
sera were generated by immunizing rabbits with a keyhole
limpet hemocyanin–coupled AUF1-derived peptide (the
N-terminal 12–amino acid motif contained in all 4 AUF1
isoforms). Animals were immunized subcutaneously with 0.8
mg peptide and boosted intravenously with 0.6 mg peptide
every 6 weeks. Antisera were collected and were used either
unpurified or peptide affinity-purified. Affinity-purified sera
were monospecific for AUF1, as tested by immunoblotting
using HeLa cellular extracts.
Immunohistochemical analysis. For immunohisto-
chemical analyses, 1–3-␮m paraffin sections of synovial tissue
obtained from patients with RA, patients with OA, and normal
subjects were mounted on poly-L-lysin–coated slides (Oligene,
Berlin, Germany), incubated overnight at 58°C, and deparaf-
finized with xylene. The affinity-purified anti-AUF1 rabbit
antibody was applied at a 1:1,500 dilution, and anti-AUF1
binding was detected using the LSAB/AP kit (Dako, Glostrup,
Denmark).
RNA protein crosslink assay. Equimolar amounts (0.3
␮M) of 32P-labeled RNA oligonucleotide and purified recom-
binant AUF1p45 or deletion mutants, respectively, were mixed
and incubated at room temperature for 20 minutes in 20 ␮l of
binding buffer (10 mM Tris HCl, pH 7.5, 1 mM EDTA, 4%
glycerol, 0.1% Triton X-100, 10 mM 2-mercaptoethanol). The
reaction mixture was transferred to a microtiter plate, put on
ice, and irradiated with an ultraviolet (UV) lamp (Stratalinker;
Stratagene, La Jolla, CA) at 254 nm at a dose of 9.9 mJ/mm2.
After the addition of Laemmli sample buffer (50 mM Tris HCl,
pH 6.8, 2% weight/volume SDS, 10% volume/volume glycerol,
5% w/v 2-mercaptoethanol, 0.01% w/v bromophenol blue), the
samples were boiled for 10 minutes and analyzed on 10%
SDS–polyacrylamide gels. The gels were dried and autoradio-
513
graphed. For quantitative analysis, an electronic autoradio-
graphy system (InstantImager; Packard, Meriden, CT) was
used.
Gel retardation assay. The binding and competition
assays were performed essentially as described above except
that samples were not UV irradiated but were immediately
transferred to 5% nondenaturing polyacrylamide gels run in
electrophoresis buffer (25 mM Tris HCl, 192 mM glycine, pH
8.3) and separated for 60 minutes at 10 V/cm. For supershift
experiments, the reactions were initially incubated for 15
minutes at 30°C, subsequently 1 ␮l of affinity-purified antibody
was added, and incubation continued for an additional 15
minutes. Finally, gels were dried and analyzed by autoradiog-
raphy.
Statistical analysis. Fisher’s exact test was used to
analyze the significance of anti-AUF1 antibody prevalences
between patient groups and between patients and healthy
control subjects and for analyzing correlations of anti-AUF1
autoantibodies with clinical features.
RESULTS
Autoantibodies to hnRNP D (AUF1) in sera from
patients with rheumatic diseases. In routine immuno-
blot analyses of patient sera, in which a preparation of
semipurified hnRNP proteins was used as an antigenic
source, prominent autoreactivity to 2 proteins with
estimated molecular masses of 45 kd and 42 kd, respec-
tively, was repeatedly observed, and was particularly
pronounced in sera from patients with SLE. To further
investigate this finding, a total of 266 sera from patients
with various rheumatic diseases were selected from the
serum bank and analyzed by immunoblotting. In these
studies, ⬃30% of SLE sera and ⬃20% of RA sera were
shown to be reactive with the 45/42 doublet (Figure 1A).
The molecular masses of the 2 proteins suggested that
they belong to the subgroup of hnRNP D proteins,
which comprises 4 members with molecular masses
between 38 kd and 45 kd generated by alternative
splicing. These proteins are better known as AUF1,
because they selectively bind to certain AU-rich ele-
ments that are frequently present in the 3⬘-UTR of
short-lived mRNA.
Therefore, we expressed the 45-kd variant of
AUF1 in Escherichia coli and investigated by immuno-
blotting whether sera reactive with the 45/42-kd antigen
also recognized the recombinant protein. In these stud-
ies, the majority of positive sera (89%) were indeed
reactive with recombinant AUF1. Moreover, antibodies
affinity-purified from recombinant AUF1 cross-reacted
with both the 45-kd and 42-kd antigens (Figure 1B), and
antibodies affinity-purified from the natural proteins
clearly recognized the recombinant protein (Figure 1C).
The 4 AUF1 isoforms differ by 2 insertions of 19
and 49 amino acids, respectively, which are contained in
514 SKRINER ET AL

Figure 1. Autoantibodies to AUF1 in sera from patients with systemic lupus erythematosus (SLE).
A, Immunoblot analysis of SLE sera using a semipurified preparation of heterogeneous nuclear
RNP proteins. Arrows indicate the positions of the 45-kd and 42-kd antigens corresponding to the
2 larger variants of AUF1. A human serum strongly reactive with both proteins was used as
reference (R) throughout the study. Pronounced anti-45/42 (AUF1) reactivities can be seen in lanes
2, 9, 13, 16, and 18. B, Immune reactivity of human autoantibodies with natural AUF1 purified from
recombinant protein p45 (lane 2). C, Recombinant 45-kd variant (AUF1p45) analyzed by Western
blotting. Serum antibodies were affinity-purified by blot elution from the native p45 (lane 2) and
p42 kd AUF1 (lane 3) proteins. Lane 1 (B and C) shows serum from a patient with rheumatoid
arthritis.

the first RRM and the C-terminal portion of the protein
(11). In order to test whether these insertions were
required for recognition by autoantibodies, the 3 shorter
variants were analyzed by immunoblotting for reactivity
with sera recognizing AUF1p45. All 4 proteins showed
comparable reactivity, demonstrating that the insertions
were not essential for antibody binding (results not
shown).
As visualized using indirect immunofluorescence
microscopy, AUF1-positive sera produced a large speck-
led nucleoplasmic staining sparing the nucleoli in inter-
phase cells (Figure 2A). To demonstrate the specificity

Figure 2. Localization of AUF1 as determined by fluorescence microscopy. A, Indirect immuno-

fluorescence staining of HEp-2 cells obtained with an anti-AUF1–positive serum sample. B,
Indirect immunofluorescence staining of HEp-2 cells obtained with an affinity-purified anti-AUF1
patient antibody. C, Localization of AUF1 in HeLa cells transfected with green fluorescent
protein–tagged AUF1. Arrows indicate staining of discrete cytoplasmic foci.
AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS
Table 1. Frequency of autoantibodies to recombinant AUF1, as
determined by immunoblotting, in sera from patients and healthy
controls*
No. of
Diagnosis sera
Systemic lupus erythematosus 70
Rheumatoid arthritis 101
Mixed connective tissue disease 30
Primary Sjögren’s syndrome 11
Polymyositis/dermatomyositis 17
Scleroderma† 44
Psoriatic arthritis 10
Reactive arthritis 31
Osteoarthritis 26
Healthy controls 25
* Specificity for systemic lupus erythematosus versus all other diseases,
90%; versus connective tissue diseases, 94%.
† Twenty-two patients had diffuse scleroderma, and 22 patients had
limited scleroderma.
of this pattern, antibodies affinity-purified from patient
sera were used (Figure 2B). In addition to the nucleo-
plasmic staining, affinity-purified anti-AUF1 antibody
stained discrete cytoplasmic foci, which were (by mor-
phologic criteria) clearly distinct from other organelles
such as mitochondria, endosomes/lysosomes, or the
Golgi complex. The location and size of discrete cyto-
plasmic foci were similar to the size and location of
P-bodies (also known as GW bodies), and these foci
concentrate enzymes involved in mRNA turnover and
sequester mRNA away from the translational machinery
(20). To further analyze localization of AUF1, HeLa
cells were transfected with green fluorescent protein
(GFP)–tagged AUF1p45, which showed a staining pat-
tern that was similar to that obtained with the affinity-
purified anti-AUF1 antibody (Figure 2C).
To investigate the autoimmune response to
AUF1 in greater detail, 365 sera from patients with
various rheumatic diseases were tested for reactivity
with purified recombinant AUF1p45 (Table 1). These
studies largely confirmed the findings obtained with the
natural proteins: IgG antibodies to AUF1 were observed
in one-third of sera from patients with SLE, in 20% of
sera from patients with RA, and in 17% of sera from
patients with MCTD, whereas no antibodies were found
in sera from patients with scleroderma or polymyositis/
dermatomyositis and, apart from a few exceptions (1
patient with primary Sjögren’s syndrome, 2 patients with
reactive arthritis, 1 patient with osteoarthritis), were
absent in patients with other rheumatic diseases.
515
Correlation of anti-AUF1 antibodies with other
autoantibodies. Sera from patients with RA or SLE are
known to contain antibodies to hnRNP A2 (9), which is
No. closely related to AUF1, showing a similar general
(%)
structure and ⬃70% homology in the 2 RRMs. How-
positive
ever, although some sera contained autoantibodies to
23 (33) both proteins, the correlation between the 2 antibody
20 (20)
5 (17) species did not reach the level of statistical significance,
1 (9) in neither patients with RA nor patients with SLE. In
0
0
patients with RA, there was also no correlation of
0 anti-AUF1 with rheumatoid factor or antibodies to
2 (7) citrullinated peptides. In patients with SLE, there was no
1 (4)
0 correlation with anti-DNA, anti-Ro, or anti-La autoan-
tibodies. Interestingly, however, an association was
found with anti-Sm antibodies, because among the 5
anti-Sm–positive sera, 4 also contained antibodies to
AUF1 (P ⬍ 0.04). Significant associations of anti-AUF1
antibodies with clinical features were not observed in
patients with SLE, patients with RA, or patients with
MCTD.
Epitope mapping. To identify the epitopes recog-
nized by anti-AUF1 autoantibodies, a series of deletion
mutants of AUF1p45 were generated. These fragments
were probed by immunoblotting with 21 selected sera
from patients with SLE (n ⫽ 7), patients with RA (n ⫽
9), and patients with MCTD (n ⫽ 5). Figure 3A shows a
typical result obtained with serum from a patient with
SLE; this serum showed full reactivity with fragments
1–262, 10–262, and 1–173 and weak reactivity with
fragment 1–145, while no reactivity was observed with
any of the other fragments. Figure 3B shows the com-
bined results obtained with 11 fragments of AUF1. All
sera showed comparable reactivity with the full-length
protein and deletion mutant 1–262, and the majority of
them (i.e., 16 of 21) were also fully reactive with
fragment 1–173 (containing the complete RRM 1),
suggesting that RRM 2 and the C-terminal part were not
essential for immunoreactivity.
In contrast, a short C-terminal truncation of
RRM 1 (fragment 1–145) led to a significant reduction
or complete loss of reactivity of all sera analyzed, and
fragment 1–70 (containing only the N-terminal domain)
was completely nonreactive. In a similar manner,
N-terminal truncations of fragment 1–262 gradually
reduced or abolished the reactivities. Thus, fragment
10–262 was still recognized by 19 sera, and fragment
30–262 was recognized by 14 of them, whereas fragment
62–262 containing both RRMs but lacking the
N-terminal domain was recognized by only 2 RA and 3
MCTD sera. Only 2 of these sera recognized fragment
105–262, while they showed no reactivity with fragment
516 SKRINER ET AL

Figure 3. Epitope mapping of AUF1. A, Reactivity of recombinant AUF1p45 fragments with a representative serum from a patient
with systemic lupus erythematosus (SLE). The positions of the NH2- and COOH-terminal amino acids of the fragments are indicated
at the top of the lanes. The top panel shows Coomassie blue staining, and the bottom panel shows results of immunoblot analysis. Lane
1, Full-length AUF1p45; lane 2, fragment 1–262 lacking the C-terminal auxiliary domain; lane 3, fragment 10–262; lane 4, fragment
20–262; lane 5, fragment 30–262; lane 6, fragment 62–262 lacking the N-terminal auxiliary domain; lane 7, fragment 1–173 comprising
the N-terminal domain and RNA recognition motif 1 (RRM 1); lane 8, fragment 1–145 lacking 28 C-terminal amino acids from RRM
1; lane 9, fragment 1–70 corresponding to the N-terminal auxiliary domain; lane 10, fragment 256–362 containing the glycine-rich
C-terminal auxiliary domain. B, Summary of the immunoblotting results obtained with 11 recombinant fragments of AUF1. The
N-terminal region of RRM 1 and RRM 2 and the glycine-rich auxiliary domain are schematically drawn; numbers above the AUF1
model designate the amino acid positions at the border of each domain. The amino acids bordering the deletion mutants are indicated.
The numbers of reactive sera are shown on the right side. The major epitope recognized by most sera was located between amino acids
1 and 173, and a minor epitope recognized by sera from some patients with rheumatoid arthritis (RA) or mixed connective tissue
disease (MCTD) was identified between amino acids 62 and 262. RBD ⫽ RNA binding domain.

137–262. No serum was reactive with either the
N-terminal or the C-terminal auxiliary domain alone.
Taken together, these analyses identified a major,
presumably discontinuous epitope composed of se-
quences contained in the N-terminal auxiliary domain
and RRM 1 (Figure 3B). This unique epitope recogni-
tion explains the lack of cross-reactivity with hnRNP A2
and A1, because these proteins do not have similar
N-terminal domains (21).
Localization of the binding site for oligonucleo-
tides containing AREs. Rapid degradation of many
unstable mRNA is regulated in part by AREs, which are
located in the 3⬘-UTR (22). It has been shown previously
that both cellular and recombinant AUF1 can bind
AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS 517

Figure 4. Interaction of AUF1 with AU-rich element (ARE). A, Binding of AUF1 and
deletion mutants to the 32P-labeled oligoribonucleotide (AUUUA)4 representing a proto-
type ARE as determined by ultraviolet crosslinking assay. Crosslinked products were
resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and autoradio-
graphed. B, AUF1–ARE gel-shift assays performed with AUF1p45 and (AUUUA)4 or the
ARE regulatory sequence of human tumor necrosis factor ␣ (TNF␣) mRNA (TNF–ARE).
For supershift assays, affinity-purified patient antibodies to AUF1 or heterogeneous nuclear
RNP A2 (hnRNP A2; Ab2) were used. The anti-AUF1 antibody was able to shift both
AUF1–ARE complexes (lanes 2 and 7), while the affinity-purified anti–hnRNP A2 control
antibody did not (lane 5). Lane 1, Complex of AUF1 with TNF–ARE; lane 2, complex
formed by the addition of anti-AUF1 antibody; lane 3, competition with nonradioactive
TNF␣ oligoribonucleotide (10⫻ molar excess); lane 4, competition with 10⫻ molar excess
of ␤-globin oligoribonucleotide; lane 5, addition of affinity-purified anti–hnRNP A2
autoantibody; lane 6, complex of AUF1 with (AUUUA)4; lane 7, complex formed by the
addition of anti-AUF1; lane 8, oligoribonucleotide (AUUUA)4. Cterm ⫽ C-terminal; COI
⫽ cold inhibition.

specifically to AREs. Using the oligonucleotide
(AUUUA)4 as a prototype ARE, the RNA-binding
properties of AUF1 fragments were investigated in UV
crosslinking assays (Figure 4A). Similar results were
obtained with the p42 and p45 variants. Compared with
the binding capacity of full-length proteins, the binding
capacity of fragment 1–262 was ⬃70%, while binding of
the RNA to fragment 1–239 (lacking 17 amino acids
from the C-terminal part of RRM 2) was reduced to
⬃40%. Fragment 1–189 (lacking RRM 2) and fragment
137–262 (lacking most of RRM 1) showed only ⬃20%
binding capacity, and no binding was visible with frag-
ment 167–262 (corresponding to RRM 2) and fragment
1–173 (N-terminus plus RRM 1) (data not shown). In
contrast, fragment 167–354, containing RRM 2 and the
entire C-terminal part, showed ⬃70% binding activity.
The C-terminal auxiliary domain also contributes
to binding, because truncation of this part led to reduced
binding capacity, and the fragment containing RRM 2
plus the C-terminal domain showed a binding capacity
similar to that of fragment 1–262. Thus, these results
were in good agreement with previous findings from
other investigators (21). Of note, fragment 1–173 (N-
terminal domain plus RRM 1), comprising the major
epitope, did not interact with the (AUUUA)4 oligo-
nucleotide. Furthermore, anti-AUF1 antibodies from
patients with SLE, RA, or MCTD did not inhibit RNA
binding (data not shown), indicating that the binding
sites for RNA and those for autoantibodies are different.
AUF1–ARE complexes are supershifted by anti-
AUF1 autoantibodies. To investigate the simultaneous
interaction of autoantibodies and ARE with AUF1,
supershift experiments were performed in which the
recombinant protein was incubated simultaneously with
RNA oligonucleotides and sera or affinity-purified pa-
tient antibodies. In these experiments, both (AUUUA)4
and the ARE of human TNF␣ mRNA were used (Figure
4B); both sequences were supershifted by affinity-
purified anti-AUF1 antibodies but not by antibodies to
hnRNP A2 obtained from the same patient. In control
competition experiments, unlabeled homologous ARE
could abolish supercomplex formation, whereas a
518 SKRINER ET AL

Figure 5. Immunohistochemical analysis of AUF1 expression in synovial tissue. Paraffin-embedded

sections of synovial tissue obtained from patients with rheumatoid arthritis (RA) (A and D), patients with
osteoarthritis (OA) (B and E), and a healthy subject (C) were stained with a polyclonal rabbit anti-AUF1
antibody (red). Strong nuclear staining (white arrows) and cytoplasmic staining (black arrows) can be seen
in RA synovial tissue, while staining appears to be strictly nuclear in OA synovial tissue. (Original
magnification ⫻ 200 in A–C; ⫻ 400 in D and E.)

␤-globin RNA oligoribonucleotide had little effect. DISCUSSION

Taken together, these data confirmed the existence of
different binding sites on AUF1 for ARE and autoanti-
bodies.
Expression of AUF1 in synovial tissue. Because
previous studies had revealed hnRNP A2 to be highly
expressed in synovial tissue from patients with RA and
arthritic mice (23,24), we analyzed the expression of
AUF1 in synovial tissue from patients with RA and
control subjects. Using rabbit antibodies recognizing the
N-terminal amino acid sequence of AUF1, expression
was investigated by immunohistochemistry in synovial
tissue from patients with RA or patients with OA, as well
as in tissue derived from normal subjects. These analyses
revealed AUF1 to be highly expressed in RA tissue,
particularly in type A synoviocytes of the lining layer and
in type B synoviocytes of the sublining areas (Figures 5A
and D). Interestingly, both nuclear expression and cyto-
plasmic expression were seen in the cells of RA synovial
tissue, especially in the lining layer, in contrast to the
exclusive nuclear staining observed in OA and normal
tissue (Figures 5B, C, and E). High expression was also
seen in endothelial cells, while weaker expression was
observed in infiltrating lymphocytes (results not shown).
In this study, we describe autoantibody responses
to the AUF1 proteins in sera from patients with rheu-
matic diseases. The antibodies were most frequently
detected in sera from patients with SLE, were reactive
with both natural and recombinant AUF1 proteins, and
did not cross-react with other nuclear proteins, including
the closely related hnRNP A/B proteins. The AUF1
proteins are multifunctional proteins that show a pre-
dominant nuclear localization. They partially colocalize
with snRNP, but are also part of cytoplasmic mRNA
decay complexes, where they mediate mRNA degrada-
tion via the exosome (25). The high expression and
partial cytoplasmic localization of AUF1 in HEp-2 and
HeLa cells as well as in synovial cells from patients with
RA leads us to suggest that non-spliceosomal structures
in the cytoplasm such as mRNA transport or mRNA
decay complexes may form autoimmune targets.
Thus, we hypothesize that cytoplasmic mRNA
decay complexes, in which AUF1 seems to play a crucial
role, might induce loss of tolerance to AUF1 not only in
patients with RA but also in patients with SLE. This
would explain the lack of association of anti-AUF1 with
antibodies to spliceosomal proteins, because the major-
AUF1 PROTEINS IN SLE AND RELATED AUTOIMMUNE DISORDERS
ity of anti-AUF1–positive patients with SLE did not
have antibodies to Sm or U1 snRNP. Because in patients
with SLE, anti-AUF1 antibodies occurred indepen-
dently of other serologic markers for this disorder such
as anti–double-stranded DNA or anti-Ro antibodies,
they might have some diagnostic value for SLE, partic-
ularly because they were absent or rare in other connec-
tive tissue diseases such as scleroderma and
polymyositis/dermatomyositis. Thus, their sensitivity and
specificity for SLE were 33% and 90%, respectively,
which is comparable with anti–U1 snRNP antibodies.
The detailed epitope mapping study performed
with sera from patients with SLE, patients with RA, and
patients with MCTD revealed that the major antigenic
region is presumably conformation dependent. The ma-
jor epitope appears to be composed of sequences con-
tained in the unique N-terminal region, which is not
shared by any other hnRNP protein, and part of RRM 1,
which shows ⬃70% homology with RRM 1 of hnRNP
A2. This epitope was recognized by most sera, whereas a
fragment containing RRM 2 was not reactive at all. This
result explains the lack of cross-reactivity with the
closely related hnRNP A2, whose major epitope is
located in RRM 2 (19). No difference in epitope recog-
nition was observed between RA and SLE sera, while 3
of 5 MCTD sera were reactive with a fragment contain-
ing both RRMs, which was not recognized at all by SLE
sera and was recognized by only 2 of 9 sera from patients
with RA. Remarkably, the C-terminal glycine-rich part
of AUF1 was not recognized by autoantibodies, a find-
ing that is consistent with the results obtained previously
for hnRNP A2 (19).
Mapping the binding site of the oligonucleotide
containing the AUUUA decay sequence confirmed that
both RRMs and the unique N-terminal domain are
required for interaction with this and other AREs.
Because anti-AUF1 antibodies can bind simultaneously
with the RNA, as demonstrated by gel-shift assays, we
speculate that the autoimmune response might be di-
rected to an initiating mRNA decay complex. Some of
the enzymes involved in mRNA degradation are con-
centrated in discrete cytoplasmic foci known as mRNA
processing bodies (P-bodies; also known as GW bodies)
(20,26,27). The most common clinical diagnosis of pa-
tients with anti-GW182 antibodies is Sjögren’s syn-
drome, followed by neurologic disease and SLE. AUF1
might be part of this decay complex, because GFP-
tagged AUF1 and affinity-purified anti-AUF1 antibod-
ies stained discrete cytoplasmic regions that might cor-
respond to P-bodies. Thus, it remains to be shown
whether AUF1 is indeed localized in such bodies or is
519
rather part of another structure formed during mRNA
decay.
One of these structures might be the exosome.
This is a large multiprotein complex of which proteins
such as AUF1, HuR, and TTP are part (28,29). These
proteins bind directly to the ARE before other proteins
associate. Binding of AUF1 seems to be essential to
form the exosome, and AUF1 is part of mRNA com-
plexes that are degraded or exported. Interestingly, 2
human exosome components, PM–Scl-100 and PM–Scl-
75, are recognized by sera from patients with the
polymyositis–scleroderma overlap syndrome (30,31).
However, the complete absence of anti-AUF1 antibod-
ies in patients with scleroderma or polymyositis/
dermatomyositis along with the absence of antiexosomal
antibodies in patients with SLE suggest that patients
with SLE do not target AUF1 contained in exosomal
complexes, while mRNA decay complexes do not appear
to form major target structures in scleroderma and
related disorders.
The investigation of AUF1 protein expression in
synovial tissue demonstrated that AUF1 proteins were
expressed in tissue from patients with RA, patients with
OA, and normal subjects. Of note, the number of cells
expressing the antigen was higher in RA synovial tissue
than in OA and normal tissue samples. Interestingly, in
RA but not OA synoviocytes, AUF1 proteins appeared
to be expressed not only in the nucleus but also in the
cytoplasm, which might be related to their established
function in regulating mRNA decay of TNF␣ and other
proinflammatory cytokines. Evidence from mice with
altered cytokine mRNA stability, along with human
data, suggests that the imbalance between the stability
and decay of inflammatory cytokine mRNA regulated by
AUF1 could represent a basic mechanism leading to
autoimmunity (32,33).
In conclusion, the AUF1 proteins have been
identified as a novel group of autoantigens in patients
with systemic autoimmune diseases, particularly SLE,
RA, and MCTD. These findings suggest that anti-AUF1
antibodies target the mRNA decay complex, which may
form another large RNP target structure in systemic
autoimmunity. We hypothesize that increased formation
of such complexes (e.g., due to overexpression of insta-
ble mRNA such as those for interleukin-1 and TNF)
may lead to pathologic autoimmune reactions against
AUF1 and other proteins of mRNA decay complexes.
AUTHOR CONTRIBUTIONS
Dr. Skriner had full access to all of the data in the study and
takes responsibility for the integrity of the data and the accuracy of the
data analysis.
520
Study design. Skriner.
Acquisition of data. Skriner, Hueber, Süleymanoglu, Höfler, Krenn.
Analysis and interpretation of data. Skriner, Steiner.
Manuscript preparation. Skriner, Smolen, Steiner.
Statistical analysis. Skriner, Steiner.
REFERENCES
1. Von Muhlen CA, Tan EM. Autoantibodies in the diagnosis of
systemic rheumatic diseases. Semin Arthritis Rheum 1995;24:
323–58.
2. Van Venrooij W, Pruijn GJ. Ribonucleoprotein complexes as
autoantigens. Curr Opin Immunol 1995;7:819–24.
3. Tan EM. Antinuclear antibodies: diagnostic markers of autoim-
mune diseases and probes for cell biology [review]. Adv Immunol
1989;4:93–151.
4. Hardin JA. The lupus autoantigens and the pathogenesis of
systemic lupus erythematosus. Arthritis Rheum 1986;29:457–60.
5. Dreyfuss G, Matunis MJ, Pinol-Roma S, Burd CG. hnRNP
proteins and the biogenesis of mRNA. Annu Rev Biochem
1993;62:289–321.
6. Tighe H, Carson DA. Rheumatoid factors. In: Kelley WN, Harris
ED Jr, Ruddy S, Sledge CB, editors. Textbook of rheumatology.
5th ed. Philadelphia: WB Saunders: 1997. p. 241–9.
7. Astaldi-Ricotti GC, Bestagno M, Cerini A, Negri R, Caporali R,
Cobianchi F, et al. Antibodies to hnRNP core protein A1 in
connective tissue diseases. J Cell Biochem 1989;40:1–5.
8. Montecucco C, Caporali R, Cobianchi F, Biamonti G. Identifica-
tion of autoantibodies to the I protein of the heterogeneous
nuclear ribonucleoprotein complex in patients with systemic scle-
rosis. Arthritis Rheum 1996;39:1669–76.
9. Hassfeld W, Steiner G, Studnicka-Benke A, Skriner K, Graninger
W, Fischer I, et al. Autoimmune response to the spliceosome: an
immunologic link between rheumatoid arthritis, mixed connective
tissue disease, and systemic lupus erythematosus. Arthritis Rheum
1995;38:777–85.
10. Pinol-Roma S, Dreyfuss G. Shuttling of pre-mRNA binding
proteins between nucleus and cytoplasm. Nature 1992;355:730–2.
11. Xu N, Chen CY, Shyu AB. Versatile role for hnRNP D isoforms
in the differential regulation of cytoplasmic mRNA turnover. Mol
Cell Biol 2001;21:6960–71.
12. Moraes KC, Quaresma AJ, Maehnss K, Kobarg J. Identification
and characterization of proteins that selectively interact with
isoforms of the mRNA binding protein AUF1 (hnRNP D). Biol
Chem 2003;384:25–37.
13. Wagner BJ, DeMaria CT, Sun Y, Wilson GM, Brewer G. Struc-
ture and genomic organization of the human AUF1 gene: alter-
native pre-mRNA splicing generates four protein isoforms.
Genomics 1998;48:195–202.
14. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, et al. The American Rheumatism Association 1987
revised criteria for the classification of rheumatoid arthritis.
Arthritis Rheum 1988;31:315–24.
15. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield
NF, et al. The 1982 revised criteria for the classification of systemic
lupus erythematosus. Arthritis Rheum 1982;25:1271–7.
16. Alarcon-Segovia D, Villareal M. Classification and diagnostic
criteria for mixed connective tissue diseases. In: Kasukawa R,
Sharp GC, editors. Mixed connective tissue diseases and anti-
nuclear antibodies. Amsterdam: Elsevier; 1987. p. 33–40.
17. Steiner G, Hartmuth K, Skriner K, Maurer-Fogy I, Sinski A,
Thalmann E, et al. Purification and partial sequencing of the
nuclear autoantigen RA33 shows that it is indistinguishable from
SKRINER ET AL
the A2 protein of the heterogeneous nuclear ribonucleoprotein
complex. J Clin Invest 1992;90:1061–6.
18. Hel Z, Di Marco S, Radzioch D. Characterization of the RNA
binding proteins forming complexes with a novel putative regula-
tory region in the 3⬘-UTR of TNF-␣ mRNA. Nucleic Acids Res
1998;26:2803–12.
19. Skriner K, Sommergruber WH, Tremmel V, Fischer I, Barta A,
Smolen JS, et al. Anti-A2/RA33 autoantibodies are directed to the
RNA binding region of the A2 protein of the heterogeneous
nuclear ribonucleoprotein complex: differential epitope recogni-
tion in rheumatoid arthritis, systemic lupus erythematosus, and
mixed connective tissue disease. J Clin Invest 1997;100:127–35.
20. Sheth U, Parker R. Decapping and decay of messenger RNA
occur in cytoplasmic processing bodies. Science 2003;300:805–8.
21. DeMaria CT, Sun Y, Long L, Wagner BJ, Brewer G. Structural
determinants in AUF1 required for high affinity binding to A ⫹
U-rich elements. J Biol Chem 1997;272:27635–43.
22. Loflin P, Chen CY, Shyu AB. Unraveling a cytoplasmic role for
hnRNP D in the in vivo mRNA destabilization directed by the
AU-rich element. Genes Dev 1999;13:1884–97.
23. Fritsch R, Eselbock D, Skriner K, Jahn-Schmid B, Scheinecker C,
Bohle B, et al. Characterization of autoreactive T cells to the
autoantigens heterogeneous nuclear ribonucleoprotein A2
(RA33) and filaggrin in patients with rheumatoid arthritis. J Im-
munol 2002;169:1068–76.
24. Hayer S, Tohidast-Akrad M, Haralambous S, Jahn-Schmid B,
Skriner K, Trembleau S, et al. Aberrant expression of the autoan-
tigen heterogeneous nuclear ribonucleoprotein-A2 (RA33) and
spontaneous formation of rheumatoid arthritis-associated anti-
RA33 autoantibodies in TNF-␣ transgenic mice. J Immunol
2005;175:8327–36.
25. Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL,
Gorospe M. Concurrent versus individual binding of HuR and
AUF1 to common labile target mRNAs. EMBO J 2004;23:
3092–102.
26. Eystathioy T, Chan EK, Tenenbaum SA, Keene JD, Griffith K,
Fritzler MJ. A phosphorylated cytoplasmic autoantigen, GW182,
associates with a unique population of human mRNAs within
novel cytoplasmic speckles. Mol Biol Cell 2002;13:1338–51.
27. Cougot N, Babajko S, Seraphin B. Cytoplasmic foci are sites of
mRNA decay in human cells. J Cell Biol 2004;165:31–40.
28. Van Hoof A, Parker R. The exosome: a proteasome for RNA?
Cell 1999;99:347–50.
29. Sully G, Dean JL, Wait R, Rawlinson L, Santalucia T, Saklatvala
J, et al. Structural and functional dissection of a conserved
destabilizing element of cyclo-oxygenase-2 mRNA: evidence
against the involvement of AUF-1 (AU-rich element/poly[U]-
binding/degradation factor-1), AUF-2, tristetraprolin, HuR (Hu
antigen R) or FBP1 (far-upstream-sequence-element-binding pro-
tein 1). Biochem J 2004;377(Pt 3):629–39.
30. Ge Q, Frank MB, O’Brien C, Targoff. Cloning of a complemen-
tary DNA coding for the 100-kD antigenic protein of the PM-Scl
autoantigen. J Clin Invest 1992;90:559–70.
31. Alderuccio F, Chan EK, Tan EM. Molecular characterization of
an autoantigen of PM-Scl in the polymyositis/scleroderma overlap
syndrome: a unique and complete human cDNA encoding an
apparent 75-kD acidic protein of the nucleolar complex. J Exp
Med 1991;173:941–52.
32. Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, Kollias
G. Impaired on/off regulation of TNF biosynthesis in mice lacking
TNF AU-rich elements: implications for joint and gut-associated
immunopathologies. Immunity 1999;10:387–98.
33. Vassalli P. The pathophysiology of tumor necrosis factors. Annu
Rev Immunol 1992;10:411–52.