Effect of RNAi knockdown of CG7786 and CG6272 on

border cell migration

Zack Troilo

12/17/2009

Biol312WL fall 2009

Abstract:

Drosophila border cell migration currently an active area of study in modern molecular biology.

Transcription factors play a central role in the differential gene expression during border cell migration.

This migration is tightly regulated in a temporal manner (stage 9) and the Slow Border Cells (Slbo)

locus is critical in this journey. Slbo codes for a homolog of the mammalian CAAT enhancer binding

protein (C/EBP) transcription factor. Slbo regulates expression of several genes involved in the

migration of the border cell cluster including DE-cadherin, Fak, Jing, and myosin VI. Here we utilized

RNAi to knockdown expression of Slbo, CG7786, and CG6272. The knockdown of Slbo caused a

failure of the border cell cluster to reach the border. The CG7786 knockdown seemed to have no effect

on border cell migration while the knockdown of CG6272 yielded interesting results. The CG6272

knockdown failed to migrate properly. Migration occurred but it seems to be random in regards to the

direction the cluster migrated. Further biochemical and molecular studies should be done to elucidate

the mechanisms involved.

Intro:

Drosophila border cell migration is currently an active area of study in modern molecular

biology. The study of Drosophila border cell migration may have medical implications by furthering

current metastatic cancer research. Many genes and proteins involved in this migration have vertebrate

homologs as a result of conservation through evolutionary pressures. Transcription factors play a

central role in the differential gene expression during border cell migration. The migrating border cell

cluster includes 2 polar cells that are surrounded by 10-12 rosette cells (Levine et al, unpublished). At

stage 9 this cluster delaminates from the epithelium and concurrent with the follicle cell epithelium

migrates from the anterior region of the egg chamber to the nurse cell-oocyte border (Horne-Badovinac

and Bilder, 2005).

This migration is tightly regulated in a temporal manner (stage 9) and the Slow Border Cells
(Slbo) locus is critical in this journey. Slbo codes for a homolog of the mammalian CAAT enhancer

binding protein (C/EBP) transcription factor (Rorth, 1994). Slbo is a leucine zipper monomer which

has has two regions of activity. One region is 35 amino acids long and aids in the dimerization with

other leucine zipper monomers. This leucine zipper region is an α -helix and named by the

characteristic leucine residues that are situated at every 7th position of the 5 reapeating heptads

(Montell et el, 1992). Slbo's transcription factor function is initiated when two slbo monomers

dimerize in a coiled-coil manner. The result is a dimer that geometrically correlates to the letter Y with

the zipper corresponding to the stem. The bifurcation point of the Y dimer corresponds to the second

region which is the basic region due to the conserved basic residues that reside in this region. The

basic region attaches to DNA in the major groove by the scissor-grip model (Vinson et al, 1989).

Slbo regulates expression of several genes involved in the migration of the border cell cluster.

One downstream regulated gene product is DE-cadherin. Others include Fak, Jing, and myosin VI

(Montell, 2003). Myosin VI is an actin based motor protein whose tasks are to stabilize the complex

that includes DE-cadherin and armadillo and to promote the projection of the lamellipodia (Geisbrecht,

2002; Montell, 2003). Slbo expression is therefore required for border cell migration however it is not

necessary for the border cells selective adhesion (Rorth, 2000). The selective adhesion of the cluster

seems to be because of unpaired expression in the polar cells to stimulate Jak-Stat signaling in the

rosette cells (Montell, 2003). The cluster delamination and migration occur at a time when Cut is only

expressed in the polar cells which activates Fas2. This polarizes the cluster giving directionality to the

journey to the oocyte border (Levine et al, unpublished).

Slbo has biological effects only when its levels are within a narrow range. Pernille Rorth in

2000 showed that slbo is regulated both in a positive and negative way. Slbo is stabilized by Ubp64

which is a presumptive ubiquitin hydrolase. Tribbles regulates Slbo negatively by ubiquinating it,

targeting Slbo for degradation as shown by higher molecular weight bands in western blots . The

border cell cluster fails to migrate when levels of Slbo are too high or too low. For proper migration it
is imperative that Slbo is properly expressed in the rosette cells surrounding the polar cells (Rorth,

2000).

C/EBP heterodimers are likely to be promiscuous in nature (Fassler et al, 2002) and the

biological functions with CG7786 are unknown. The CG7786 gene encodes a b-zip transcription factor

monomer (Fassler et al, 2002) that displays a b-zip motif and forms heterodimers. CG7786 monomers

form promiscuous heterodimers with C/EBP (Deppman et al, 2006). If the CG7786 b-zip transcription

factor does indeed dimerize with C/EBP, then it could have a role in delayed border cell migration.

CG6272 is also a dimerization partner of interest in this study. Here, we show that CG6272 RNAi

knockdown has a definite effect on border cell migration while CG7786 knockdown has no effect.

Results and Discussion:

In order to study possible interactions with Slbo we wanted to clone two candidate drosophila b-

zip transcription factor monomers: CG7786 and CG6272. We then knocked down their expression

with RNAi. When Slbo was expressed the RNAi to CG7262 and CG7786 was also expressed. If there

was a failure in border cell migration it may have therefore been because of a molecular mechanism

connecting the knocked down gene (CG7262 or CG7786) and Slbo expression.

Cloning of CG7786 and CG6272 and Tribbles induction

Gel electrophoresis of CG7786 and CG6272

The PCR first products produced were not of the highest quality. Since, CG7786 is 579 bp long

we expected to see a sharp distinct band around 579 on the control ladder. However, on our first trial

the control ladder was bad and this threw off our results. This is because the ladder is the standard bp

scale for measurement. The CG7786 foreward and reverse primer lane had also diffused out a bit

causing a blurry gel band. This could be caused by several or a single band diffusing out. Figure 1

shows gel for CG7786 and CG6272 clones

Cloning and diagnosis of CG7786 into bacterial vector

Our group must have had an issue with our workup because we did not get any results from our
plasmid cutting. We had to borrow another classmates purified plasmids, and using our restriction

enzymes and her plasmids we finally experienced results. The gel in figure 2 is the resulting gel. The

signals are faint but visible bands are present. The number of bands created indicated the number of

places a restriction enzyme cut on the plasmid and in CG7786. Lanes E-G showed the clearest results.

Tribble induction

We set out to determine if we could get the TRBL gene transduced and activated in the bacterial

hosts. We succeeded in doing just that. The gene was introduced and activated as demonstrated by our

SDS-polyacrylamide protein gel (Figure 3). We did demonstrated that a dilution of 400 µ L SB to the

soluble and insoluble fractions yielded better results when electrophoresed at 200 volts based on the

better banding seen in the gel lanes. There were many bands that separated out.

Sequence analysis of CG7786 and CG6272

The blast data did not show any drosophila data which is wrong because when this was done

with other researchers results were obtained. Due to time constraints on the project this issue was not

resolved. However, the data from other team memebers should elucidate better BLAST data.

Developmental analysis of CG6272 and CG7786 RNAi knockdown and Xgal

Immunofluorescence

The RNAi knockdown of CG6272 resulted in a border cell cluster that was not well organized.

The rosette cells even seperated from the polar cell during one migration. The cluster also seemed to

just migrate in random directions. The cluster was seen past the nurse cell-oocyte border and also in the

lateral follicle cell epithelium. CG6272 was expressed in both the polar and rosette cells of the cluster.

See figure 4.

XGAL

The RNAi knockdown results of CG62762 was partly consistant with the immunofluorescence

experiments. The border cell cluster migrated past the border again however the staining shows that
the rosette cells maintained good contact with the polar cells. See figure 5.

proposed molecular models of CG6272 action

There seemed to be a constant failure in migration with the CG6272 RNAi knockdown.

CG6272 does not seem to play a role in the initial formation of the border cell cluster but it may have a

role in activating genes involved in maintaining that cluster.

Materials and Methods:

The protocols that follow were adapted from “Laboratory in Genetics, Cell and Developmental

Biology” (Dobens, 2009).

Cloning of CG7786 and CG6272 and Tribbles induction

Isolating DNA

25 anesthetized curly winged flies were placed in a 1.5 mL microtube and ground in 400 µ L of

a buffer containing: 100 mM Tris-HCl, pH 7.5, 100 mM EDTA, pH 8, 100 mM NaCl, 0.5% sds. Then

the tube was incubated at 65o for 30 minutes. 800 µ L of a salt solution added and placed on ice for 10

minutes to precipitate out proteins from DNA. The salt solution contained: 1 mL KAc from 5 M stock,

2.5 mL LiCl from 6 M stock, and 1.5 mL deionized water. The microtubes were then microfuged for

15 minutes. The supernatant was then poured over to a different tube and 600 µ L isopropanol added

and tube mixed well. The microtubes were microfuged for 15 minutes and the supernatant again

poured off. The remaining DNA pellet was then washed in 70% ethanol and pellet allowed to air dry.

PCR Design

Two test and two control solutions were formulated with foreword and reverse primers for

CG7786 and CG6272. The primers were: 1) reverse CG6272 – TTAGTCATTGTCCTTGGG 2)

foreward CG6272 - ATGCCGGCCAAAAAGAGA 3) CG7786 reverse -

TCACACCTGCCTGGCCATGGACAAC 4) CG7786 foreward -

ATGCACTCGCCCGCCCAGTGCCCCATTTTC. Tube 1 had foreword and reverse primers for

CG7786, tube 2 had foreword primer of CG7786, tube 3 had foreword and reverse primers for

CG6272, and tube 4 had only foreword primers for CG6272. CG7786 tubes were tests and CG6272

tubes were a control. Also in each tube was 47 mL of mastermix. The mastermix was a solution of 30

mL MgCl, 210 mL deionized water, 30 mL 10X Taq polymerase buffer, and 12 mL dNTP’s.

Gel electrophoresis

A TAE gel was electrophoresed with two 20 µ L samples of the amplified PCR products from

both CG7786 and CG6272. 4 µ L of tracking buffer was added to the 20 µ L samples. The middle

lane was used for the exACT gene control ladder. The gel was run for 50 minutes on 75 volts. The

resulting gel was stained with ethidium bromide for 30 minutes on a slow rocking rocker. Photos were

then taken with a UV transilluminator. Another gel was run with modified TAE and a new ladder. The

resulting gel was then used for the cloning procedures, however, no results were taken down on this

gel.

CG7786 PCR products were recovered from the modified TAE gel utilizing the Ultrafree-DA

kit. A small slice from the CG7786 band was cut out and placed in the nebulizer and spun in the

microfuged for 10 minutes. For the ligation, 4 µL of PCR products placed in an eppendorf tube with 1

µL AccepTorTM vector, 5 µL ClonablesTM 2X ligation premix. For the transformation, two tubes

were prepared, one for the test and one for the control. A tube of NovaBlue SinglesTM Competent

Cells was taken out of freezer and thawed on ice. In the test tube 1 µL of ligation product added with 1

µL of cells. In a second tube 1 µL of test plasmid placed in with cells. Both tubes placed on ice for 5

minutes. Both tubes then placed in water at 42oC for exactly 30 seconds and then placed back on ice

for 2 minutes. 125 µL SOC medium added to the tubes and tubes allowed to shake for 30 minutes to

promote outgrowth of bacteria. 50 µL from each tube were then placed on the LB agar and spread over

the plate. After the incubation 6 tubes were made with 5 mL of LB solution. 6 different CFU’s from

the ligation plate were then inoculated in the 6 LB tubes. For the purification of the plasmids, 1.5 mL
of LB solution were added to 6 eppendorf tubes and spun in microfuged until the max speed was

reached. The pellets then dried. 100 µL of solution A was added and then vortexed to resuspend the

pellet. Solution A contained 10 mL total: 2 mg/ml lysozyme, 10 mg of crystal, 50 mM glucose, 0.25

mL of 1M, 10 mM EDTA, and 0.1 mL of 0.5M. The tubes were then placed on ice for 30 minutes. 200

µL of solution B then added and tubes inverted several times by hand to mix and then placed on ice for

5 minutes. Solution B contains: 0.2N NaOH and 1% SDS. 150 µL of solution C added to tubes, the

tubes were inverted by hand to mix, and then placed on ice for 30 minutes. Solution C contains: 3 M

NaAc pH 5.2. The 6 tubes were then microfuged for 10 minutes. 1 mL of 100% ethanol added and and

tubes microfuged for 5 minutes. The ethanol was then poured off and pellet dried. 200 µL of solution

D added and then tube vortexed. Solution D contains: 55 mM Tris pH 8 buffer and 0.3 M NaAc. 60

µL of ethanol added and tubes microfuged for 5 minutes. This solution was poured off and pellet dried.

The pellet was then re-suspended in 100 µL of water.

Diagnosis of CG7786 insertion into vector

When the gel was run for the diagnosis of insertion of CG7786 with our purified plasmids

nothing happened. In a second round of workup we used Susan’s purified plasmids from her labeled

microtubes 5 and 50. The NEBcutter website was used to determine the best restriction endonucleases

to use to splice out CG7786 from the vector if transformation was successful. The 3 restriction

enzymes used were ClaI, SacI, and HinfI.

In the second workup we used 6 tubes, tubes 1-3 utilized Susan’s #5 and 4-6 utilized Susan’s

#50 from Susan’s tube 50. Tube 1 had 9 µ L DNA, 2 µ L nuclease buffer at 10X, 0.5 µ L of ClaI, 8.5

µ L water, and 10 µ L loading buffer. Tube 2 had 9 µ L DNA, 2 µ L nuclease buffer at 10X, 0.5 µ L of

HinfI, 8.5 µ L water, and 10 µ L loading buffer. Tube 3 had 9 µ L DNA, 2 µ L nuclease buffer at 10X,

0.5 µ L of SacI, 8.5 µ L water, and 10 µ L loading buffer. Tube 4 had 9 µ L DNA, 2 µ L nuclease

buffer at 10X, 0.5 µ L of ClaI, 8.5 µ L water, and 10 µ L loading buffer. Tube 3 had 9 µ L DNA, 2 µ L
nuclease buffer at 10X, 0.5 µ L of HinfI, 8.5 µ L water, and 10 µ L loading buffer Tube 2 had 9 µ L

DNA, 2 µ L nuclease buffer at 10X, 0.5 µ L of SacI, 8.5 µ L water, and 10 µ L loading buffer. The

Loading buffer was added after 15 minutes of cutting. A gel was then run.

TRBL induction

A 50 mL uninduced culture was induced with IPTG to a 1 mM and placed on the shaker. Two 1

mL aliquots were taken out before the induction and then in 30 minute intervals from the intitial time to

the 2 hour mark. After each 1 mL aliquot was taken out it was immediately centrifuged at max speed

for 1 minute. The supernatant was then removed and the pellet tap dried. The pellets were then

resuspended in 100 µ L of 1X PBS. 100 µ L of the 2X sample buffer was then added and sonicated.

For the sonication settings contact Dr. Dobens. The tubes then were heated for 3 minutes in a water

bath at 70oC and then stored in the freezer.

The remaining 40 mL induced culture was spun in microfuged for 5 minutes. A resuspension in

4 mL cold 20 mM Tris 7.5 was made. The solution was transferred to 15 mL tube and capped with 0.4

mL of 10mg/mL lysozyme and incubated for 15 minutes on ice and then sonicated. 1.5 mL was then

transferred to 2 tubes and microfuged for 10 minutes creating pellets. The supernatant was then

transferred to a fresh tube and 200 µ L of 2X sample buffer was added. The tube was then heated for 3

minutes in a water bath at 70oC to denature and stored in the freezer. The pellets that were formed

were washed in 750 µ L of 20 mM Tris 7.5 and centrifuged for 5 minutes. A resuspension was then

made in 1.5 mL of 1% SDS by sonication. A 200 µ L sample was transferred to a separate tube and

200 µ L SB added and heated at 70oC for 3 minutes and placed in the freezer.

Protein analysis by SDS-polyacrylamide gels

We obtained a preformed polyacrylamide gel and assembled the electrophoresis machine. 125 mL
solution of Tris/glycine/SDS running buffer was added to the inner core until the inner glass plate was

covered. Buffer was then added until it touched the gel. The 6 tubes from the TRBL induction prep

were spun for 2 minutes and heated at 75oC for 90 seconds. The tubes were then diluted with 400 µ L

of SB. 3 ML were added to the lanes and the gel was ran at 200 volts for about 30 minutes. When the

gel was dried it cracked into pieces as shown in

Sequence analysis of CG7786 and CG6272

A nucleotide BLAST was run with both CG7786 and CG6272 primers: 1) reverse CG6272 –

TTAGTCATTGTCCTTGGG 2) foreward CG6272 - ATGCCGGCCAAAAAGAGA 3) CG7786

reverse - TCACACCTGCCTGGCCATGGACAAC 4) CG7786 foreward -

ATGCACTCGCCCGCCCAGTGCCCCATTTTC . All the default settings were used in the BLAST.

Preparations of CG6272 and CG7786 knockdown ovaries

Xgal staining

Anesthetized flies were separated out and their ovaries dissected out and placed in premixed

solution of 400 µ L PBS and BSA. Once collected, the ovaries were washed in 400 µ L 1X PBS in a

1.5 mL microtube. The PBS was pipetted out and ovaries fixed with a solution 400 µ L of 4%

paraformaldehyde and PBS for 15 minutes. The fix was removed and the ovaries washed 3 times in

400 µ L PBS for 5 minutes. The wash was removed and 400 µ L of embryo stain solution with Xgal.

The solution was then incubated overnight. The next day the stain solution was removed and the

ovaries were washed 3 times in PBT. The egg chambers were released from the ovaries by pipetting

them several times. The egg chambers were then washed in a solution of 50% glycerol in PBS. The

eggs were then mounted in 50% glycerol in PBS on a slide and analyzed by light microscopy. For any

solution contents please contact Dr. Dobens.

Immunofluorescence

Anesthetized flies were separated out and their ovaries dissected out and placed in premixed solution of
400 µ L PBS and BSA. Once collected, the ovaries were washed in 400 µ L 1X PBS in a 1.5 mL

microtube. The PBS was pipetted out and ovaries fixed with a solution 400 µ L of 4%

paraformaldehyde and PBS for 15 minutes. The fix was removed and the ovaries washed twice in 400

µ L NPS. The wash was removed and blocked with 250 µ L and 150 µ L of NPS overnight. The block

solution was removed and the ovaries washed two times in 400 µ L of NPS at 5 minutes per wash. The

egg chambers were released from the ovaries by pipetting them several times. 1:50 NPS:Drosophila E-

cadherin antisera was added by the lead researcher (Dr. Dobens). Then he removed the excess primary

stain and washed 2 times in NPS. A secondary antisera protocol was then done by Dr. Dobens. We

then removed this secondary stain and washed 3 times in NPS. The final wash was done in 1X 50%

glycerol in PBS for 5 minutes. The eggs were then mounted in 50% glycerol in PBS on a slide and

analyzed by confocal microscopy.

Fly strains
The ovaries came from flies that were the results of the cross between SLBO GAL4, UAS-GFP

x UAS-SLBO and SLBO GAL4, UAS-GFP/Cyo x 10709 (SLBO RNAi). Other researchers prepared

the lines for the CG6272 and CG7786 knockdowns

----------------------------------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------------------------------
Figure 1. TAE and 1.5% agarose gel with a poor control ladder in the middle lane. The ladder should have 10 bands
instead of the 3 that cam out.. One the very bottom lane there is a blurred area around the assumed 579 bp region. In the
second to lowest lane was a string of bands which should not have been there. On the very top lane is CG6272. This band
shows the same diffuse bands as CG7786

Figure 2. Plasmid gel. A) lane for the ladder B) 5, ClaI C) 5, HinfI D) 5, SacI E) 50, ClaI F) 50, HinfI G) 50, SacI

Figure 3. The solutions of the soluble fraction and insoluble fractions that were diluted with 1X SB ran better at 200 volts
A) Kaleidoscope ladder B) 0 minutes C) 30 minutes D) 60 minutes E) 120 minutes F) soluble fraction G) insoluble fraction
H) soluble fraction diluted with 400 ML solution of 1X SB I) insoluble fraction diluted with 400 ML solution of 1X SB
Figure 4. (1) RNAi knockdown of CG7786 had no effect (2-4) RNAi knockdown of CG6272 displays random migration
with slides 2 and 3 showing disorganized border cell clusters. In slide 2 a rosette cell totally dissociates from the cluster.

Figure 5. (2) RNAi knockdown of CG7786 resulted in a weak failure of the border cells to migrate in. (1) shows that the
border cells have made it to the border. (3) RNAi knockdown of CG6272 resulted in no failure of migration. The border
cell cluster maintained its integrity as a migrating cluster. (4) Border cell cluster did maintain its integrity, however, the
cluster overshot the border and looks to have migrated into the oocyte.
Sources

Christopher Deppmann, Rebecca Alvania, and Elizabeth Taparowsky. 2006. Cross-Species Annotation
of Basic Leucine Zipper Factor Interactions: Insight into the Evolution of Closed Interaction Networks.
Mol. Biol. Evol. 23(8): 1480-1492

Sally Horn-Badovinac and David Bilder. 2005. Mass Transit: Epithelial Morphogenesis in the
Drosophila Egg Chamber. Dev. Dyn. 232: 559-574

Jan Fassler, David Landsman, Asha Acharya, et al. 2002. B-ZIP Proteins Encoded by the Drosophila
Genome: Evaluation of Potential Dimerization Partners. Genome Res. 12:1190-1200.

Denise J. Montell. 2003. Border Cell Migration: the Race is on. Nature Reviews. 4: 13-24.

Benjamin Levine, Jennifer F. Hackney, Andrew Bergen, Leonard Dobens III, Angela Truesdale and
Leonard Dobens. Unpublished. Opposing interactions between Drosophila Cut and the C/EBP encoded
by Slow Border Cells direct apical constriction and epithelial invagination. Unpublished data

Denise Montell, Pernille Rorth, and Allan Spradling. 1992. Slow Border Cells, a Locus Required for a
Developmentally Regulated Cell Migration during Oogenesis, Encodes Drosophila C/EBP. Cell 71: 51-
62.

Pernille Rorth. 1994. Specification of C/EBP Function During Drosophila Development by the BZIP
Basic Region. Science 266: 1878-1881.

Pernille Rorth, Kornelia Szabo, and Gemma Texido. 2000. The level of C/EBP Protein is Critical for
Cell Migration during Drosophila Oogenesis and is Tightly Controlled by Regulated Degradation.
Molecular Cell. 6: 23-30.

Erika R. Geisbrecht and Denise J. Montell. 2002. Myosin VI is required for E-cadherin-mediated
border cell migration. Nature Cell Biology. 4: 616 - 620

Charles Vinson, Paul Sigler, and Steven McKnight. 1989. Scissors-Grip Model for DNA Recognition
by a Family of Leucine Zipper Proteins. Science 246: 911-916