American Society of Critical Care Anesthesiologists

Section Editor: Michael J. Murray

Low Tidal Volume and High Positive End-Expiratory

Pressure Mechanical Ventilation Results in Increased
Inflammation and Ventilator-Associated Lung Injury in
Normal Lungs
Caron M. Hong, MD, Da-Zhong Xu, MD, PhD, Qi Lu, MD, Yunhui Cheng, PhD, Vadim Pisarenko, MD,
Danielle Doucet, MD, Margaret Brown, MSN, Seena Aisner, MD, Chunxiang Zhang, MD, PhD,
Edwin A. Deitch, MD, and Ellise Delphin, MD, MPH
BACKGROUND: Protective mechanical ventilation with low tidal volume (VT) and low plateau
pressure reduces mortality and decreases the length of mechanical ventilation in patients with acute
respiratory distress syndrome. Mechanical ventilation that will protect normal lungs during major
surgical procedures of long duration may improve postoperative outcomes. We performed an animal
study comparing 3 ventilation strategies used in the operating room in normal lungs. We compared
the effects on pulmonary mechanics, inflammatory mediators, and lung tissue injury.
METHODS: Female pigs were randomized into 3 groups. Group H-VT/3 (n 6) was ventilated
with a VT of 15 mL/kg predicted body weight (PBW)/positive end-expiratory pressure (PEEP) of 3
cm H2O, group L-VT/3 (n 6) with a VT of 6 mL/kg PBW/PEEP of 3 cm H2O, and group L-VT/10
(n 6) with a VT of 6 mL/kg PBW/PEEP of 10 cm H2O, for 8 hours. Hemodynamics, airway
mechanics, arterial blood gases, and inflammatory markers were monitored. Bronchoalveolar
lavage (BAL) was analyzed for inflammatory markers and protein concentration. The right lower
lobe was assayed for mRNA of specific cytokines. The right lower lobe and right upper lobe were
evaluated histologically.
RESULTS: In contrast to groups H-VT/3 and L-VT/3, group L-VT/10 exhibited a 6-fold increase in
inflammatory mediators in BAL (P 0.001). Cytokines in BAL were similar in groups H-VT/3 and
L-VT/3. Group H-VT/3 had a significantly lower lung injury score than groups L-VT/3 and L-VT/10.
CONCLUSION: Comparing intraoperative strategies, ventilation with high PEEP resulted in increased
production of inflammatory markers. Low PEEP resulted in lower levels of inflammatory markers. High
VT/low PEEP resulted in less histologic lung injury. (Anesth Analg 2010;110:165260)

rotective mechanical ventilation with low tidal volume (Vt) and low plateau pressure has been shown
to reduce mortality and decrease the length of mechanical ventilation in patients with acute respiratory distress syndrome (ARDS) compared with traditional high Vt
ventilation.1 Prospectively, the ARDS Network database
revealed beneficial effects of decreasing Vt from 12 mL/kg
predicted body weight (PBW) to 6 mL/kg PBW regardless
of plateau pressures.1 The efficacy of protective ventilation
in acute lung injury (ALI) and ARDS has resulted in a
progressive decrease in Vt used by clinicians during surgery in patients with normal lungs. This practice has
developed without evidence-based support. In a review,
Schultz et al.2 recommended the use of Vt 10 mL/kg,
From the Department of Anesthesiology, University of Medicine and
Dentistry of New JerseyNew Jersey Medical School, Newark, New Jersey.
Accepted for publication November 24, 2009.
Supported by Department of Anesthesiology, University of Medicine and
Dentistry of New JerseyNew Jersey Medical School, Newark, NJ.
Disclosure: The authors report no conflicts of interest.
Address correspondence to Ellise Delphin, MD, MPH, UMDNJNew Jersey
Medical School, 185 South Orange Ave., MSB E-538, Newark, NJ 07103.
Address e-mail to delphiel@umdnj.edu.
Copyright 2010 International Anesthesia Research Society
DOI: 10.1213/ANE.0b013e3181cfc416

1652

www.anesthesia-analgesia.org

plateau pressure 15 to 20 cm H2O, and positive endexpiratory pressure (PEEP) 5 cm H2O to ventilate patients
with normal lungs, based on expert opinion and currently
available evidence.
Ventilator-induced lung injury (VILI) has been described after ventilation with high volume and pressure
(barotrauma) and low volume secondary to cyclic opening
and closure of peripheral airways.3,4 Ex vivo models of
normal rodent lungs ventilated with physiologic Vt
caused functional alterations, histologic injury, and release of proinflammatory cytokines.5,6 Subsequent in
vivo studies in normal anesthetized rabbits ventilated at
low Vts revealed histologic injury and increases in
airway resistance.7 Extensive histologic damage with
airway closure results in cytokine release.8 Small-animal
studies have demonstrated increases in cytokines, tumor
necrosis factor (TNF)-, interleukin (IL)-1, IL-6, and
IL-8 with large Vt and long-duration mechanical ventilation.5,6,9,10 Human prospective studies comparing mechanical ventilation strategies have had inconsistent
results.1113 Studies of short-duration mechanical ventilation have found no differences in release of mediators.
Others have demonstrated increased levels of inflammatory mediators and poorer outcomes in patients ventilated with large Vts for longer periods of time.14 17
June 2010 Volume 110 Number 6

Figure 1. Outline of the study. VT tidal volume; PEEP positive

end-expiratory pressure.

The ability to provide mechanical ventilation that will

not injure and may protect normal lungs during major
surgical procedures of long duration may improve postoperative outcomes and decrease morbidity and mortality.
Our hypothesis was that low-Vt/high-PEEP short-term (8
hours) protective ventilation would produce less pulmonary inflammation and injury than ventilation with
high-Vt or low-PEEP strategies in noninjured lungs. An in
vivo animal study was performed that compared high- and
low-Vt ventilation strategies with different PEEP values.

METHODS
The study was approved by the New Jersey Medical School
Animal Care and Use Committee. Female Yorkshire pigs
(Animal Biotech Industries, Danboro, PA) weighing approximately 30 kg were acclimatized over a period of 5 to
7 days before procedures. The study strictly abided by the
guidelines of the National Institutes of Health Guide for the
Care and Use of Laboratory Animals.

Animal Preparation
Female pigs were anesthetized with ketamine (20 mg/kg,
IM) and xylazine (2.0 mg/kg, IM) and placed in the supine
position. Each animal was intubated with an endotracheal
tube and end-tidal CO2 was verified. Anesthesia was
maintained with 2 minimal alveolar concentration isoflurane. The femoral artery was cannulated with a 22-gauge
catheter and used for continuous arterial blood pressure
monitoring. The right carotid artery was cannulated with a
20-gauge catheter. This catheter tip was at the junction of
the aortic arch and was verified postmortem. The internal
jugular vein was cannulated with an 8F sheath. A pulmonary artery catheter (Swan-Ganz) was inserted, and pulmonary artery pressures were continuously monitored. These
procedures were completed within 1 hour of intubation
(Fig. 1).

Experimental Protocol
Vital signs including temperature, heart rate, arterial blood
pressure, and oxygen saturation were continuously monitored and recorded every 15 minutes. Heart rate was
maintained between 120 and 140 bpm, mean arterial blood
pressures at 70 to 72 mm Hg, and pulmonary artery

June 2010 Volume 110 Number 6

pressures (systolic) at 20 to 23 mm Hg (Table 1). Temperature was maintained at 99 to 103F using an appropriate
warming or cooling apparatus (i.e., forced-air warmer/
cooler) and oxygen saturation at 98% to 100%. Normal
saline (0.9%) was administered as maintenance fluid at a
rate of 4 to 8 mL/kg/h, with all animals receiving similar
amounts of total IV fluids over 8 hours. Hypotension, as
defined by a mean arterial blood pressure 50, was treated
with fluid boluses of 250 mL of normal saline (0.9%). Mean
airway pressure and peak inspiratory pressure (PIP) were
monitored continuously and recorded every 30 minutes.
Arterial blood gas samples were obtained hourly. Preand postpulmonary blood samples were obtained from the
pulmonary artery and aortic catheters, respectively, hourly
for 8 hours after intubation.
At the completion of 8 hours of mechanical ventilation,
a bronchoalveolar lavage (BAL) was performed. All animals were then humanely euthanized. Tissue samples from
the right upper lobes (RULs) and right lower lobes (RLLs)
of the lung were harvested and stored at 80C under
sterile conditions. Samples of each tissue were immediately
fixed for histologic analysis.

Ventilation Protocol
Animals were randomized into 3 groups and their lungs
ventilated with volume control using a Drager Narkomed 4
ventilator (Drager). Group H-Vt/3 (n 6) was ventilated
with a Vt of 15 mL/kg and 3 cm H2O PEEP. Group L-Vt/3
(n 6) was ventilated with a Vt of 6 mL/kg and 3 cm H2O
PEEP. Group L-Vt/10 (n 6) was ventilated with a Vt of
6 mL/kg and 10 cm H2O PEEP. Respiratory rate was
adjusted to maintain Paco2 at 35 to 50 mm Hg and pH at
7.35 to 7.5. The inspiratory/expiratory ratio was 1:2. The
fraction of inspired oxygen (Fio2) was maintained at 50%
throughout the procedure for all animals. Arterial blood
gas samples were taken hourly to verify adequate oxygenation, ventilation, and acid-base status.

Bronchoalveolar Lavage
BAL was performed after the completion of 8 hours of
mechanical ventilation before euthanization. Twenty milliliters of sterile normal saline was used for the lavage. The
volume of return was recorded and the samples were
centrifuged for 15 minutes at 2500g. The supernatant was
aliquoted and stored at 80C until the time of assays. BAL
protein concentration was determined using a refractometer (TS400, Reichert, Depew, NY).

Cytokine Measurements
Ten milliliters of serum from each sample was collected in
15-mL nonpyrogenic, sterile falcon tubes prelung (pulmonary artery) and postlung (aortic arch). Each sample was
centrifuged at 2500g for 15 minutes at 4C to remove
cellular components, and the supernatant was aliquoted
and immediately stored at 80C until the time of assays.
BAL and plasma concentrations of TNF-, IL-1, IL-6,
IL-8, IL-10, and IL-12 were measured using commercially
available enzyme-linked immunosorbent assay kits (R&D
Systems, Minneapolis, MN) that contained respective standards for production of standard curves and controls. All
enzyme-linked immunosorbent assays were performed by

www.anesthesia-analgesia.org

1653

High vs Low Tidal Volume Ventilation in Normal Lungs

Table 1. Parameters and Variables for Ventilation Strategies (8 h of Mechanical Ventilation)

H-VT/3
Hemodynamics
Mean arterial pressure (mm Hg)
Heart rate
Respiratory parameters
pH
Bicarbonate (HCO3) (mmol/L)
Partial pressure oxygen (mm Hg)
Partial pressure of carbon dioxide (mm Hg)a
Tidal volume (mL)
Positive end-expiratory pressure (cm H2O)
Respiratory variables
Mean airway pressure (cm H2O)
Peak inspiratory pressure (cm H2O)
Respiratory rate

72 4.5
111 4.2

L-VT/3

L-VT/10

70 3.7
113 3.3

69 4.5
109 6.4

7.5 0.007*
32.5 0.5
247 9.2
35 1.8*
15 mL/kg
3

7.44 0.007
33.3 0.6
222 7.5
47 1.8
6 mL/kg
3

7.39 0.03
34.4 0.7
251 10.7
50 2.0
6 mL/kg
10

9.3 0.3
26.4 0.87
12 0.5

6.9 0.4
17.7 1.28
34 0.5

14.7 0.7
23.6 0.70
30 1.1

After 1 h.
* P 0.02 compared with other groups.
P 0.002 compared with other groups.
P 0.005 compared with L-VT/3.
P 0.001 compared with other groups.

a single researcher following the guidelines from the manufacturer and were analyzed at 450 nm using SOFTmax PRO
4.3 LS software (Molecular Devices, Sunnyvale, CA). Background absorbency of blank wells was subtracted from
standards and unknown samples before determining concentrations. The detection limits for these kits were 3.7 pg/mL for
TNF-, 10 pg/mL for IL-1, and IL-6, 4.6 pg/mL for IL-8, 3.5
pg/mL for IL-10, and 9 pg/mL for IL-12.

mRNA Analysis by Quantitative Real-Time

Reverse Transcription Polymerase
Chain Reaction

RLL lung tissues previously stored at 80C were homogenized, and total RNA was extracted using the TRIzol Isolation
Kit (Invitrogen Life Technologies, Carlsbad, CA) according to
the manufacturers protocol. Purified RNA 200 ng was reverse
transcribed, generating cDNA by using the manufacturers
protocol for the Retroscript Detection Kit (Ambion, Austin,
TX). Amplification and detection of specific products were
performed using the ABI PRISM 7700 Sequence Detection
System with the cycle profile according to the protocol for the
ABsolute SYBR Green ROX Mix Kit (ABgene, Rockford, IL).
As an internal control, glyceraldehyde-3-phosphate dehydrogenase primers were used for RNA template normalization.
Fluorescent signals were normalized to an internal reference,
and the threshold cycle (Ct) was set within the exponential
phase of the polymerase chain reaction (PCR). The target PCR
Ct values were normalized by subtracting the glyceraldehyde-3phosphate dehydrogenase Ct value (Ct). The relative
expression level between treatments was then calculated
using the following equation: relative gene expression
2(Ct sample Ct control). Each sample was tested in
triplicate. The primers (5-3) used for each cytokine were
([S]-sense and [AS]-antisense):
TNF-: [S] GCAACCTGGGACATCTGGAATG/[AS]
GGTGAAATCTTCTCAAGGAATGTTCTG
IL-1: [S] CCCTACCCTCTCTAGCCAGTCTAC/[AS]
TGTTGTCACCATTGTTAGCCATCAC
IL-6:
[S]
ATGAACTCCCTCTCCACAAGCG/[AS]
GCATCACCTTTGGCATCTTCTTCC

1654

www.anesthesia-analgesia.org

IL-8:
[S]
GGACCAGAGCCAGGAAGAGAC/[AS]
GGGTGGAAAGGTGTGGAATGC
IL-10: [S] TTTCTTTCAAACGAAGGACCAGATG/[AS]
GCAACCCAGGTAACCCTTAAAGTC
IL-12: [S] CTGAAGTCTCTCCTAACCTTAAAGTC/[AS]
CCCAGTTCCTAACCCATACCC

Histology
The lungs harvested from the pigs were immediately fixed
in 10% buffered formalin. Samples from the most dorsal
portion of the RLL and the most ventral portion of the RUL
were selected and fixed. After fixation, the tissue samples
were dehydrated and embedded in paraffin blocks. The
sections were cut to 4-m thickness and stained with
hematoxylin and eosin (H&E). A surgical pathologist,
blinded to the study variables, evaluated each sample
histologically to determine a lung injury score. Our definition of lung injury score was a quantitative measurement to
determine the extent of lung inflammation and damage in
each animal and to stratify the level of injury by the totals.
Five random fields were analyzed using light microscopy
at 100 magnification. Each lung section was analyzed
using a histologic grading scale based on the work of
Claridge et al.18 This histologic grading scale scored inflammation (0 3), interstitial edema (0 3), congestion (0 3),
atelectasis (0 3), alveolar integrity (0 3), acute inflammation (0 3), and interstitial thickening (0 3). The total lung
injury score ranged from 0 to 21, 0 representing minimal to
no damage and 21 the worst damage possible.

Statistical Analysis
All data were statistically analyzed using SPSS version 15.0
(SPSS, Chicago, IL). The 3 groups were compared using
1-way analysis of variance with appropriate use of post hoc
analysis to isolate significant between-group differences.
Results were expressed as mean sem. P values 0.05
were considered significant.

ANESTHESIA & ANALGESIA

RESULTS
Effects of Different Ventilator Strategies on
Hemodynamics and Gas Exchange
All hemodynamic variables were similar within all 3
groups and maintained within the ranges noted in the
Methods section. All animals requiring fluid boluses responded appropriately and no other intervention was
necessary to maintain hemodynamic variables.
pH was between 7.35 and 7.5 during the protocol in all
animals. There was a significant difference in pH between
the high- and low-Vt strategies. Group H-Vt/3 had significantly higher pH (7.5 0.008) than group L-Vt/3 (7.44
0.008) and group L-Vt/10 (7.39 0.03) (Table 1).
Paco2 was between 33 and 55 mm Hg in all groups.
Group H-Vt/3 maintained significantly lower Paco2 from
hour 1 through hour 8. Both low-Vt strategies had significantly higher Paco2 than H-Vt/3 after 1 hour of mechanical ventilation (Fig. 2A). Partial pressure of arterial oxygen
(Pao2) was similar in all 3 groups (Fig. 2B).
Respiratory rate was significantly different between the
high- and low-Vt strategies because it was adjusted to
maintain a Paco2 55 mm Hg in all groups. There were no
differences in respiratory rate between the 2 low-Vt strategy groups.
Figure 2. Effects of different ventilation strategies on PaCO2 and
PaO2. A, PaCO2 over 8 hours of mechanical ventilation. *P 0.05,
group H-VT/3 versus groups L-VT/3 and L-VT/10. #P 0.001, group
L-VT/3 versus group L-VT/10 at hour 1. B, PaO2 over 8 hours of
mechanical ventilation.

Effects of Different Ventilation Strategies on

Respiratory Mechanics
Mean airway pressures were highest in group L-Vt/10
(14.7 0.7 cm H2O) versus groups H-Vt/3 (9.3 0.3 cm

Figure 3. Effects of different ventilator strategies on airway mechanics. A, Average mean airway pressure mean SEM over 8 hours of
mechanical ventilation. *P 0.002, group H-VT/3 versus group L-VT/3 after hour 3. **P 0.001, group L-VT/10 versus other groups. B,
Average peak inspiratory pressures mean SEM over 8 hours of mechanical ventilation. *P 0.005, group H-VT/3 versus group L-VT/3. **P
0.005, group L-VT/3 versus other groups. ***P 0.01, group L-VT/10 versus group H-VT/3 after hour 6.

June 2010 Volume 110 Number 6

www.anesthesia-analgesia.org

1655

High vs Low Tidal Volume Ventilation in Normal Lungs

compared with group L-Vt/3 (17.7 1.28 cm H2O, P

0.005). After hour 6, group L-Vt/10 had significantly lower
PIP than group H-Vt/3 (P 0.01) (Fig. 3B).

Effects of Different Ventilation Strategies on

Cytokine Production
Bronchoalveolar Lavage
BAL was done at the completion of 8 hours of mechanical
ventilation. Lavages were performed with 20 mL sterile
normal saline with return volumes of 8 to 10 mL in all
animals. Group L-Vt/10 had significantly increased BAL
levels of TNF-, IL-1, IL-6, and IL-8 compared with both
groups H-Vt/3 and L-Vt/3 (P 0.001) (Fig. 4A). There
were no differences in BAL cytokine IL-10 and IL-12 levels
among the 3 groups (Fig. 4A).
BAL protein concentrations were higher in group
L-Vt/10 (14.3 0.8 mg/mL, P 0.001) versus group
H-Vt/3 (1.2 0.07 mg/mL, P 0.001) and group L-Vt/3
(8.3 0.8 mg/mL, both P 0.001). Group L-Vt/3 had an
intermediate protein level significantly lower than group
L-Vt/10 but higher than group H-Vt/3 (P 0.001)
(Fig. 4B).
Quantitative reverse transcription PCR analysis
(mRNA) of the RLL lung tissue revealed correlating data
with significantly higher levels of TNF-, IL-1, IL-6, and
IL-8 in group L-Vt/10 versus the other 2 groups (P 0.05)
(Fig. 4C).
Serum
We assayed cytokines TNF-, IL-1, IL-6, IL-8, IL-10, and
IL-12 in prelung blood via pulmonary artery catheter and
postlung blood via aortic catheter. There were no significant differences in any cytokines within each group prelung and postlung. There were also no differences among
the 3 groups.

Effects of Different Ventilation Strategies on

Lung Injury

Figure 4. Effects of 8 hours of mechanical ventilation on bronchoalveolar lavage (BAL). A, Significant cytokine levels in BAL mean SEM.
*P 0.001, group L-VT/10 versus other groups. B, BAL protein
concentration mean SEM. *P 0.001, group H-VT/3 versus other
groups. **P 0.001, group L-VT/3 versus other groups. ***P
0.001, group L-VT/10 versus other groups. C, mRNA of right lower
lobe lung tissue mean SEM. *P 0.05, group L-VT/10 versus other
groups.

H2O, P 0.001) and L-Vt/3 (6.9 0.4 cm H2O, P 0.001).

Group H-Vt/3 had significantly higher mean airway pressures than group L-Vt/3 after hour 3 (Fig. 3A).
PIP was higher in both groups H-Vt/3 (26.4 0.87 cm
H2O) and L-Vt/10 (23.6 0.70 cm H2O, P 0.005)

1656

www.anesthesia-analgesia.org

H&E stains were done for each animal in each ventilation

group for the RLL and the RUL. Gross histologic evaluation
of the RLL demonstrated that group H-Vt/3 showed
inflammatory cell migration and vascular congestion with
alveolar and perivascular edema. The majority of alveoli
remained intact, with minimal gross alveolar collapse and
no alveolar hemorrhage (Fig. 5A). Group L-Vt/3 showed a
segmental histology within the RLL, more profound than
the other groups. Portions were similar to the histology in
group H-Vt/3. Unique to this group, there were other
areas of gross alveolar hemorrhage with early thrombi
formation and a high level of vascular congestion (Fig. 5B).
Group L-Vt/10 showed an increase in alveolar and
perivascular edema compared with group H-Vt/3. Vascular congestion and alveolar collapse were found with gross
invasion of macrophages and polymorphonuclear leukocytes. Of the 3 groups, group L-Vt/10 had the greatest
global level of edema and congestion. No alveolar hemorrhage was seen in group L-Vt/10 (Fig. 5C). The histologic
descriptions above were of areas with the highest level of
lung injury in each group. All animals within each group

ANESTHESIA & ANALGESIA

Figure 6. Average lung injury score with 3 different ventilation

strategies. Right lower lobe: *P 0.02, group H-VT/3 versus other
groups. Right upper lobe: **P 0.04, group H-VT/3 versus other
groups.

with minimal alveolar collapse, with no alveolar hemorrhage in any group.

Evaluation by a blinded surgical pathologist revealed an
RLL total lung injury score range of 2 to 12.5 and an RUL
range of 2 to 10. The ranges of lung injury scores reflect a
nonuniform picture of injury within each group. Although
the H&E slides depict unique findings in each group, there
were areas that lacked high levels of injury. Group H-Vt/3
had significantly lower lung injury scores in both the RLL
and RUL compared with the low-Vt groups (P 0.02) (Fig.
6). There were no significant differences between the
low-Vt groups, L-Vt/3 and L-Vt/10 (Fig. 6).

DISCUSSION

Figure 5. Representative hematoxylin and eosin stains of the right

lower lobe from animals ventilated with H-VT/3 (A) with intact alveoli,
minimal vascular congestion, mild edema, and inflammatory cell
migration. Group L-VT/3 (B) with alveolar hemorrhage and global
alveolar edema and vascular congestion. Group L-VT/10 (C) with
increased alveolar and perivascular edema, increased vascular
congestion, and inflammatory cell migration.

demonstrated the unique findings depicted with each representative histologic slide. The RUL was similar histologically, revealing a range of inflammatory cell migration,
vascular congestion, and alveolar and perivascular edema

June 2010 Volume 110 Number 6

This study was designed to evaluate the effects of 3

different ventilator strategies on the inflammatory response
and lung injury in anesthetized animals with noninjured
lungs. We have evidence that ventilation with low Vt/high
PEEP is associated with increased levels of inflammatory
mediators compared with ventilation with high Vt/low
PEEP. This is contrary to current data demonstrating that
ventilation with high Vt and low or zero PEEP results in
the development of greater local and systemic inflammatory responses.6,9,10,19 22 Therefore, this study questions
whether the variables of mechanical ventilation beneficial
in ARDS can be extrapolated to result in similar effects in
noninjured lungs.
Mechanical ventilation is associated with adverse effects, including atelectasis and VILI. Atelectasis occurs in
90% of patients undergoing general anesthesia.23 The result
is decreased compliance, impaired oxygenation, and potentially, lung injury. Acute extreme lung stretching and high
airway pressures have been found to contribute to severe
parenchymal changes increasing permeability of the
alveolar-capillary barrier, resulting in pulmonary edema,
parenchymal damage, increased inflammation, and ultimately, VILI.3 Modification of the ventilator strategy may
reduce lung injury in acutely injured lungs. Whether these
strategies can be used with similar results in noninjured
lungs is unknown.
The large, multicenter, prospective ARDS Network
clinical trial unambiguously confirmed that mechanical

www.anesthesia-analgesia.org

1657

High vs Low Tidal Volume Ventilation in Normal Lungs

ventilation with lower Vts (6 mL/kg PBW), rather than

traditional Vts (12 mL/kg PBW), and low plateau pressures (30 cm H2O) resulted in a significant increase in
ventilator-free days and a reduction in mortality.24 These
variables maximize alveolar recruitment and aeration with
minimal shearing stresses and pulmonary strain. The efficacy of protective ventilation in ALI has encouraged its use
in the operating room for patients with normal lungs. Yet,
this practice is controversial and lacks evidence-based
support.
To limit sources of inflammation, our study animals did
not undergo a surgical procedure. The association of surgery and activation of acute-phase inflammatory and immunologic factors has been well established. Both duration
of surgery and the amount of blood loss are associated with
higher levels of inflammation.25,26 There may be a similar
increase in inflammatory response with prolonged mechanical ventilation alone. Our study has uniquely investigated the effects of mechanical ventilation within normal
physiologic variables with minimal surgical stimulation
and 8 hours of ventilation.
We demonstrate that increased continuous airway pressure associated with high PEEP increases the pulmonary
inflammatory response. Our data agree with data of Chu et
al.27 showing that overdistention and stretch of the pulmonary epithelium result in an increase in inflammatory
cytokine production and is therefore more injurious to
normal lungs. This is not consistent with the clinical study
by Wolthuis et al.,21 who demonstrated that low Vt with 10
cm H2O PEEP may limit pulmonary inflammation in
noninjured mechanically ventilated patients. The differences in airway pressures in our study may contribute to
our experimental results.
Our study suggests there may be upper and lower
airway pressures in noninjured lungs above or below
which lung injury may occur. Beyond these limits, there
may be substantial barotrauma from overdistention, a
greater degree of atelectasis, and mechanical injury caused
by cyclic opening and closing of alveoli. In normal animal
lungs, our study demonstrated that higher PEEP resulted in
increased lung injury. Few studies have been done that
effectively determine airway pressures that induce injury in
normal lungs. Further studies should determine airway
pressures that will minimize inflammation, barotrauma,
and mechanical sheer injury.
Mechanical ventilation itself promotes inflammation.
Our results demonstrate that ventilation strategies differ in
inflammatory response. Ventilation with low Vt/high
PEEP demonstrated the greatest increase in inflammatory
cytokines. Tremblay et al.,5 in contrast, demonstrated in an
ex vivo animal model that high Vt with no PEEP increased
the in situ inflammatory response. However, this ex vivo
rodent model ventilated animals with extremely large Vt
that lie outside the variables used in normal human subjects. Our study, which used more conventional Vt, demonstrated significantly less inflammation with low PEEP
ventilation. This inflammatory response was identified in
BAL with a 6-fold increase in the proinflammatory cytokines TNF-, IL-1 and IL-6, and chemotaxic cytokine IL-8
with low Vt/high PEEP. These cytokine findings were a
direct result of inflammation within the lung parenchyma

1658

www.anesthesia-analgesia.org

with no changes systemically. This may be attributed to

direct transcriptional upregulation of cytokine production
by the pulmonary epithelium stimulated by overdistention,
such as IL-8.28 31 Other cellular components within the
lungs (i.e., alveolar macrophages) may contribute to this
acute inflammatory response to mechanical ventilation.
This study correlated molecular inflammation with histologic lung injury. We demonstrated that ventilation with
high Vt/low PEEP was associated with the least lung
injury. Although all groups had equivalent oxygenation,
there were histologic findings that were unique to each
group. Our histologic findings correlate with the ex vivo
small-animal study that demonstrated that ventilation with
low Vt/no PEEP resulted in increased inflammation
caused by cyclic opening and closing of alveoli.27 The
nonuniform appearance of the low Vt/low PEEP group,
with regions of less inflammation and injury, may be
attributable to mechanical injury only in certain regions.
Therefore, this injury may have been dependent on other
factors, such as size of the alveoli and amount of surfactant,
because alveoli in other sections remained intact. Despite
this mechanical injury, ventilation with low Vt/low PEEP
did not result in as dramatic increases in inflammatory
mediators as did ventilation with low Vt/high PEEP. This
demonstrates that higher PEEP may play a significant role
in inducing inflammation during mechanical ventilation.
Ventilation with high Vt/low PEEP demonstrated the least
lung injury. However, whether these histologic findings
contribute to differences in overall lung function, postoperative recuperation, and morbidity is still unclear.
Despite the range of inflammation and histologic injury,
our results demonstrated that all animals in all groups had
adequate gas exchange and equivalent oxygenation. Many
researchers, including Wolthuis et al.,21 demonstrated significant differences in Paco2 among ventilation groups. In
our study, there was a significant difference in Pco2 (Paco2)
and pH between high- and low-Vt strategies. Although the
2 low-Vt strategies had higher Paco2, there was no resultant acidosis and therefore no physiologic alterations because of this significant increase. To further validate our
findings, the 2 low-Vt groups had similar Paco2 levels and
dramatic differences in BAL cytokine findings and histology. Tolerated increased Paco2 (permissive hypercapnia)
has been shown to be beneficial in the treatment of ARDS
and ALI. Hypercapnic acidosis has protective effects, associated with improved pulmonary edema, decreased lung
stiffness, and markedly decreased levels of cytokines, particularly TNF- and IL-6.32 One could postulate that increase in Paco2, similar to that found in our low-Vt
strategies, may have a decreased inflammatory response,
but this is not the case. We have demonstrated that
ventilation with low Vt/high PEEP is associated with
greater pulmonary inflammatory response and parenchymal injury.
Although this study revealed significant findings regarding different ventilation strategies in normal lungs,
there were limitations. The study was performed in a
limited number of animals. Normal pig lungs may react
differently than adult human lungs ventilated similarly.

ANESTHESIA & ANALGESIA

Differences in chest wall anatomy between pigs and humans may cause differences in the injury caused by mechanical ventilation. The study was performed on a small
number of young swine. Their lungs may react differently
than those of older animals or humans ventilated similarly.
Because of the ventilator used, we were unable to measure
plateau pressure, auto-PEEP, or pressure volume loops.
Our inability to measure end-inspiratory pressure limits
the ability to determine whether the results were caused by
PEEP or by tidal overdistention due to high-end pressure.
Future studies should be done to correlate the relationship
between high PEEP ventilation and plateau pressures. We
performed a single BAL at the end of 8 hours of mechanical
ventilation rather than at multiple time points during the
protocol. We were unable to distinguish whether each
cytokine increased at different time points or constantly
throughout ventilation. The BAL samples were taken before euthanasia to eliminate any effects from the physiologic changes caused by euthanasia in the samples (i.e.,
decreased cardiac output and hypoxia). Finally, our 3
ventilation strategies used a PEEP of either 3 or 10 cm H2O.
Additional research is needed to determine the effects of
PEEP within this range (i.e., PEEP of 5 or 8 cm H2O). It
would be valuable to determine a level of PEEP above
which lung injury occurs.

CONCLUSIONS
We demonstrated that mechanical ventilation with high PEEP
associated with high mean airway pressures resulted in
increased pulmonary inflammation. Low PEEP resulted in
lower levels of inflammatory markers. High Vt (15 mL/kg
PBW), low PEEP (3 cm H2O), and low mean airway pressure
resulted in less pulmonary inflammation and parenchymal
damage in normal, noninjured animal lungs compared with
other low-Vt mechanical ventilation strategies. These findings
support the use of larger Vts and PEEP 10 cm H2O to
ventilate patients with normal lungs. Pulmonary physiology
is dramatically different between ARDS and noninjured
lungs. We have demonstrated that ventilation strategies used
in patients with ARDS may not be appropriate for patients
with noninjured lungs. We believe that the question of which
ventilatory strategy will protect normal human lungs remains unanswered. Large human clinical trials with outcome
analysis remain necessary to elucidate the best strategy for
ventilation of uninjured lungs to improve postoperative recuperation and morbidity.
REFERENCES
1. Amato MBP, Barbas CSV, Medeiros DM, Magaldi RB, Schettino GP, Lorenzi-Filho G, Kairalla RA, Deheinzelin D, Munoz
C, Oliveira R, Takagaki TY, Carvalho CRC. Effect of protectiveventilation strategy on mortality in the acute respiratory
distress syndrome. N Engl J Med 1998;338:34754
2. Schultz MJ, Haitsma JJ, Slutsky AS, Gajic O. What tidal
volumes should be used in patients without acute lung injury?
Anesthesiology 2007;106:1226 31
3. Dreyfuss D, Saumon G. Ventilator-induced lung injury: lessons
from experimental studies. Am J Respir Crit Care Med
1998;157:294 323
4. DAngelo E, Pecchiari M, Della Valle P, Koutsoukou A, MilicEmili J. Effects of mechanical ventilation at low lung volume
on respiratory mechanics and nitric oxide exhalation in normal
rabbits. J Appl Physiol 2005;99:433 44

June 2010 Volume 110 Number 6

5. Tremblay LN, Miatto D, Hamid Q, Govindarajan A, Slutsky

AS. Injurious ventilation induces widespread pulmonary
epithelial expression of tumor necrosis factor-alpha and
interleukin-6 messenger RNA. Crit Care Med 2002;
30:1693700
6. Tremblay L, Valenza F, Ribeiro SP, Li J, Slutsky AS. Injurious
ventilatory strategies increase cytokines and c-fos m-RNA
expression in an isolated rat lung model. J Clin Invest
1997;99:944 52
7. DAngelo E, Pecchiari M, Baragge P, Saetta M, Balestro E,
Milic-Emili J. Low volume ventilation causes peripheral airway injury and increased airway resistance in normal rabbits.
J Appl Physiol 2002;92:949 56
8. DAngelo E, Koutsoukou A, Della Valle P, Gentile G, Pecchiari
M. Cytokine release, small airway injury, and parenchymal
damage during mechanical ventilation in normal open-chest
rats. J Appl Physiol 2008;104:419
9. Pugin J, Dunn I, Jolliet P, Tassaux D, Magnenat J, Nicod LP,
Chevrolet J. Activation of human macrophages by mechanical ventilation in vitro. Am J Physiol 1998;275:1040 50
10. Von Bethmann AN, Brasch F, Nusing R, Vogt K, Volk HD,
Muller KM, Wendel A, Uhlig S. Hyperventilation induces
release of cytokines from perfused mouse lung. Am J Respir
Crit Care Med 1998;175:26372
11. Koner O, Celebi S, Balci H, Cetin G, Karaoglu K, Cakar N.
Effects of protective and conventional mechanical ventilation
on pulmonary function and systemic cytokine release after
cardiopulmonary bypass. Intensive Care Med 2004;30:620 6
12. Wrigge H, Zinserling J, Stuber F, von Spiegel T, Hering R,
Wetegrove S, Hoeft A, Putensen C. Effects of mechanical
ventilation on release of cytokines into systemic circulation in
patients with normal pulmonary function. Anesthesiology
2000;93:14137
13. Wrigge H, Uhlig U, Zinserling J, Behrends-Callsen E, Ottersbach G, Fischer M, Uhling S, Putensen C. The effects of
different ventilatory settings on pulmonary and systemic inflammatory responses during major surgery. Anesth Analg
2004;98:775 81
14. Choi GC, Wolthuis EK, Bresser P, Levi M, van der Poll T,
Dzoljic M, Vroom MB, Schultz MJ. Mechanical ventilation with
lower tidal volumes and positive end-expiratory pressure
prevents alveolar coagulation in patients without lung injury.
Anesthesiology 2006;105:689 95
15. Zupancich E, Paparella D, Turani F, Munch C, Rossi A,
Masseccesi S, Ranieri M. Mechanical ventilation affects inflammatory mediators in patients undergoing cardiopulmonary
bypass for cardiac surgery: a randomized clinical trial. J Thorac
Cardiovasc Surg 2005;130:378 83
16. Lee PC, Helsmoortel CM, Cohn SM, Fink MP. Are low tidal
volumes safe? Chest 1990;97:4259
17. Wrigge H, Uhlig U, Baumgarten G, Menzenbach J, Zinserling
J, Ernst M, Dromann D, Welz A, Uhlig S, Putensen C. Mechanical ventilation strategies and inflammatory responses to cardiac surgery: a prospective randomized clinical trial. Intensive
Care Med 2005;31:1379 87
18. Claridge JA, Enelow RI, Young JS. Hemorrhage and resuscitation induced delayed inflammation and pulmonary dysfunction in mice. J Surg Res 2000;92:206 13
19. Michelet P, DJourno XB, Roch A, Doddoli C, Marin V,
Papazian L, Decamps I, Bregeon F, Thomas P, Auffray JP.
Protective ventilation influences systemic inflammation after
esophagectomy. Anesthesiology 2006;105:9119
20. Vlahakis NE, Schroeder MA, Limper AH, Hubmayr RD.
Stretch induces cytokine release by alveolar epithelial cells in
vitro. Am J Physiol 1999;277:L16773
21. Wolthuis EK, Choi G, Dessing MC, Bresser P, Lutter R, Dzoljic
M, van der Poll T, Vroom MB, Hollmann M, Schultz MJ.
Mechanical ventilation with lower tidal volumes and positive
end-expiratory pressure prevents pulmonary inflammation in
patients without preexisting lung injury. Anesthesiology
2008;108:46 54

www.anesthesia-analgesia.org

1659

High vs Low Tidal Volume Ventilation in Normal Lungs

22. Ranieri VM, Suter PM, Tortorella C, De Tullio R, Dayer JM,

Brienza A, Bruno F, Slutsky AS. Effect of mechanical ventilation on inflammatory mediators in patients with acute respiratory distress syndrome. A randomized controlled trial.
JAMA 1999;281:54 61
23. Duggan M, Kavanagh P. Atelectasis in the perioperative
patient. Curr Opin Anesthesiol 2007;20:37 42
24. The Acute Respiratory Distress Syndrome Network. Ventilation with lower tidal volumes as compared with traditional
tidal volumes for acute lung injury and the acute respiratory
distress syndrome. N Engl J Med 2000;342:1301 8
25. Yamada T, Hisanaga M, Nakajima Y, Kanehiro H, Watanabe A,
Ohyama T, Nishio K, Sho M, Nagao M, Harada A, Matsushima
K, Nakano H. Serum interleukin-6, interleukin-8, hepatocyte
growth factor, and nitric oxide changes during thoracic surgery. World J Surg 1998;23:78390
26. Yim APC, Wan S, Lee TW, Arifi AA. VATS lobectomy reduces
cytokine responses compared with conventional surgery. Ann
Thorac Surg 2000;70:2437

1660

www.anesthesia-analgesia.org

27. Chu EK, Whitehead T, Slutsky AS. Effects of cyclic opening

and closing at low- and high-volume ventilation on bronchoalveolar lavage cytokines. Crit Care Med 2004;32:168 74
28. Hammerschmidt S, Kuhn H, Sack U, Schlenska A, Gessner C,
Gillissen A, Wirtz H. Mechanical stretch alters alveolar type II
cell mediator release toward a proinflammatory pattern. Am J
Respir Cell Mol Biol 2005;33:20310
29. Pugin J. Molecular mechanisms of lung cell activation induced
by cyclic stretch. Crit Care Med 2003;31:S200 6
30. Halbertsma FJJ, Vaneker M, Scheffer GJ, van der Hoeven JG.
Cytokines and biotrauma in ventilator-induced lung injury: a
critical review of the literature. Neth J Med 2005;63:38292
31. Lang CJ, Barnett EK, Doyle IR. Stretch and CO2 modulate the
inflammatory response of alveolar macrophages through independent changes in metabolic activity. Cytokine 2006;
33:346 51
32. De Smet HR, Bersten AD, Barr HA, Doyle IR. Hypercapnic
acidosis modulates inflammation lung mechanics, and edema
in the isolated perfused lung. J Crit Care 2007;22:30513

ANESTHESIA & ANALGESIA