2010 A Level h2 Biology Serangoon JC

2
CANDIDATE NAME (CG) - - - - - - - - - INDEX NUMBER _ _ _ _ 1. Identify whether the following organelles are commonly found in animal cells, plant cells,
or both animal and plant cells .
SERANGOON JUNIOR COLLEGE
JC2 PRELIMINARY EXAMINATION 2010
I. chloroplasts a. animal cells
BIOLOGY Paper 1 (MCQ)- 9747i9648 ii. mitochondria b. plant cells
Higher 2
iii. large vacuole c. both animal and plant cells
Friday
27 Aug ust 2010 iv. ribosome
v. nucleolus
1 hour 15 mlns
Additional materials: Optical Mark Sheet
A I= b; ii = c j iii= c; lv= c ; v=c
B I =a ; II= b; iii =a; lv= c; v=a
c i = c; II= c; iii= b; lv= a; v=b
INSTRUCTIONS TO CANDIDATES 0 l=b; il = c; Iii= b; lv= c; v=c
Write your name, CG and index number in the spaces at the top of this page.
Enter your name, subject title, test name, class. For your index number enter the number 2 2. Wh ich of the following(s) is/a re true about cellulose and collagen?
'
followed by the last four digits of your NRIC number. Shade the corresponding lozenges on
1. Both serve as structural components as they have high tensile strength
the OMS according to the instructions given by the invigilators.
2. The high tensile strength is a result of inter-chain hydrogen bonds
3. Both show quaternary level of organization
There are forty questions in this paper. Answer all questions. For each question, there are
four possible answers, A, B, C, D. Choose the one you consider correct and record your
A 1 only
choice in soft pencil on the OMS. B 1 and 2 only
C 1 ,2 and 3 only
D 2 only
AT THE END OF THE EXAMINATION, HAND IN BOTH OMS AND QUESTION PAPERS.
3. Which of the following food samples requires the largest amount of oxygen to oxidize it
INFORMATION FOR CANDIDATES completely?
Each correct answer will score one mark. A mark will not be deducted for a wrong answer. A 1 g of amino acid
Any rough working should be done on the question paper. B 1 g of fat
C 1 g of monosaccharide
D 1 g of polysaccharide
This question paper consists of 21 printed pages and 1 blank page.
www.gradtutors.com
3 4
4. Equal quantities of a 5% starch solution were added to equal quantities of different 6 . Fractionation is a process used to separate cell components according to their size and
solutions. After 5 minutes at room temperature, the solutions were tested with iodine in density. The diagram shows the main steps in fractionation of a plant cell.
potassium iodide solution and the depth of colour was recorded using a colorimeter (with
u
an arbitrary scale of 1 to 5, 5 being the darkest blue).
- - - - - - - - mlx111ra ten1rti'Uged
The results are given in the table. at low speed
Solution Colorimeter cells broken open

reading In buffer soluHon
1 saliva and dilute HCI 4
supematant removed
w
2 saliva and dilute NaHC03 1
--------------~and~mrtN~
3 dilute HCI only 4 at a higher speed
4 saliva at 100C 5
5 saliva at 20C 3 lledlment 1
largest and densest
organelles sink to lila boUom
This experiment suggests that saliva contains a biologically active substance which
A
B
C
D
hydrolyses starch in acid conditions.
is denatured by hydrochloric acid.
is promoted in its action by high temperatures.
may be activated by hydrogencarbonate ions.
u
sedlinent2
next largest and densest
organelles sink to tho bottom
supernatant removed
- - - - - - - - and cen1rti'Ugad
at a higher speed
5. The enzyme amylase hydrolyses starch into disaccharides. Amylase is unable to

breakdown cellulose because
A
B
cellulose does not contain glycosidic bonds.
starch consists of glucose; cellulose consists of other monosaccharides.
"
u
sodiment3
- - - - - - - - - the proce88 Is repeated until all
next l8ryest and densest

aganeHas sink to the bottom
the organelles are separated
C the bonds between sugars in cellulose are much stronger.

D the sugars in cellulose are bonded together differently than in starch, hence cellulose DCPIP and buffer solution were added to each sediment and the mixtures left in the
have a different shape. light for fifteen minutes. Sediment 2 caused the oxidised DC PIP to be reduced .
Which organelles are present in sediment 2?
A mitochondria
B chloroplasts
C ribosomes
D nuclei
www.gradtutors.com
5 6
7. Assume that the average amino acid residue has a molecular weight of 110. The DNA 9. What is the basis for the difference in the synthesis of the leading and lagging strands of
strand coding for a polypeptide chain of molecular weight 20,000 has a length of DNA molecules?
A 182 nucleotides I. The anti-parallel arrangement of the DNA strands.

B 252 nucleotides 11. The RNA primers are required to initiate DNA elongation.
C 540 nucleotides Ill. DNA polymerase joins new nucleotides to the 3' end of the growing strand.
D 760 nucleotides IV. Helicase and single-stranded binding proteins work at the 5'end of the DNA strand.
A II and IV
8. The following is part of the normal sequence of an mRNA molecule. B I and Ill
C I and IV
CCAUAGUGGUCCGUAAAAUGGC D II and Ill
A mutation in the DNA resulted in a polypeptide beginning with the following sequence.
10. D, E, F and G are the four daughter cells resulting when cell A undergoes meiosis,_ If no
glycine - serine- proline- glycine -isoleucine crossing over occurred during the meiotic event, which cells listed below, if any, arei\
genetically identical?
The DNA triplets for some amino acids are:
Glycine
CGA
Proline
CCA
Leucine
TTA
Serine
TCA
Isoleucine
ATA
0
GGT
GGC
CCG CTT
CTC
TCG ATT
I
~// ----.0
Which mutation has occurred in the DNA molecule?
A Addition of an extra nucleotide

~ '0 c!J '0
B Reversal in the order of nucleotides
A Band C
C Loss of a nucleotide
D Replacement of one nucleotide by a different nucleotide B D, E, F & G
C D & E; F &G
D None
www.gradtutors.com
7 8
11 . The table below shows some of the events which take place in protein synthesis. Questions 13 and 14 refer to the following information.
1 !RNA molecules bring specific 'am ino acids to the ribosome. Encephalitis is a general medical term for inflammation of the brain of humans. It is typically
2 Ribonucleotides join w ith exposed DNA bases and fomn a molecule of mRNA caused by viruses. One such virus is the West Nile virus, which carries a single stranded
3 Release factor binds to mRNA positive sense RNA
4 Peptide bonds formed between amino acids.
5 mR('JA molecule leaves the nucleus.
6 mRNA undergoes capping and addition of poly(A) taiL 13. Suggest how the virus replicates its genome?
Which of the following shows the correct sequence of events?
A It uses the host RNA polymerase.
A 256143 B It uses RNA polymerase encoded for within its own genome.
8 265143 C It uses reverse transcriptase encoded for within its own genome
c 265134 D It uses the host DNA polymerase.
D 256134
14. Wh ich of the following explain how the West Nile virus can cause encephalitis?
12. E.coli bacteria are grown in a culture of nutrients which includes glucose and lactose as
the main source of carbon-based nutrient A The vi rus enters neurons in the brain by endocytosis thus disrupting the ionic balance
across the membrane.
B The virus replicates within the neurons in the brain this leading to physical damage to
the brain cells upon its lytic re lease.
C.Og'cel1 C The virus triggers an auto-immune response leading to the brain cells being broken
riumber
down.
D The vi rus is destroyed by white blood cells in the blood leading to its accumulation in
bra in tissue .
'\_
~
15. Which of the following is an example of a possible step in the post-transcri ptional control
of gene expression?
Tlfll~
Which of the following statements accounts for the growth curve showing the
A Gene amplification during a stage in development
reproduction of E. coli bacteria?
B The removal of introns and splicing together of exons.
p Q C The binding of tr~nscri ption factors to a promoter.
R
D The add ition of methyl groups to cytosine bases of DNA
A Lactose is Production of enzymes for lactose Glucose is
metabolised metabolism is repressed metabolised
B Lactose Is Enzymes for lactose metabolism Glucose is
metabolised is produced metabolised
c Glucose Is Production of enzymes for lactose Lactose is
metabolised metabolism is repressed metabolised
D Glucose is Enzymes for lactose metabolism Lactose is
metabolised is produced metabolised
www.gradtutors.com
9 10
16. The incidence of cancer increases dramatically with age because 18. Investigator Sala-Chen wanted to determine the function of a protein X, which was
known to bind to DNA. He cloned the gene encoding the protein into Plasmid .t .He then
A the Ras protein is more likely to be hyperactive after age sixty. engineered a second plasmid, Plasmid 2, with a binding site for the protein Xlocated
B as we age, normal cell division inhibitors cease to function . upstream of a reporter gene, which codes for the synthesis of a product that is easily
C the longer we live, the more mutations accumulate. measured.
D tumour suppressor genes are no longer able to repair damaged DNA.
'
17. A student has 2 cultures of cells. Culture A consists of normal cells, whi le culture 8
consists of cells which were isolated from a tumor and divide uncontrollably. He wants to
determine if the uncontrolled growth of cells in culture 8 was the result of activation of an
oncogene or the mutation of a tumour suppressor gene. He decides to fuse the cells
from the two cultures to form a hybrid line containing DNA from both cells.
The list of possible results and the conclusions drawn from the experiment are P~&mid2
summarized by the student in the table below:
Resulting growth of hybrid cells Type of gene mutated In the

,,
"
When both plasm ids were introduced into the same bacterial cells, there was significant
tumor increase in the reporter gene transcripts, compared to cells which were only transformed
(1) Grows normally Activated oncogene with plasmid 2.
(2) Grows uncontrollably Activated oncogene
(3) Grows normally Mutated tumour suppressor gene Which of the following statements is a likely conclusion regarding gene X or protein X?
(4) Grows uncontrollably Mutated tumour suppressor gene

- - - - ---
-
A Gene X is an enhancer sequence.
Only two of the conclusions are correctly matched with the possible results. The two 8 Gene X is a promoter sequence.
C Protein X is a DNA polymerase.
correct poss ibilities are
D Protein X is a transcription factor.
A (1) and (3)

8 (1)and(4)
19. A strain of toad has only one nucleolus in the nucleus of each cell instead of the usual
C (2) and (3)
D (2) and (4) two. When toads with one nucleolus per cell are mated, approximately a quarter of the
offspring have two nucleoli per nucleus, half have one nucleolus per nucleus and a
quarter have no nucleoli.
I
What is the most likely explanation of these results?
A The possession of one nucleolus is due to autosomal linkage.

B The possession of one nucleolus is due to the heterozygous condition.
C The allele for the presence of two nucleoli i~ recessive.
D The allele for the presence of two nucleoli is dominant.
www.gradtutors.com
11 12
20. In a species where the female is homogametic, a sex-linked allelic pair of genes controls 22. There are two hypotheses to explain the production of wh ite, pale pink or dark pink
pigmentation. The following results were obtained during the course of a breeding flowers in a species of plant.
experiment.
hypothesis 1 : There are two codominant alleles.
<tTa hypothesis 2 : There are three alleles, one for each flower colour .
...l9
I i .....---.,(J 1
9-0
Which procedu re is the best way of testing these hypotheses?
' (Pl (Q)

A Analysis of the flower pigments in several different flowers by chromatography to find
whether some piants contain more than one pigment.
t:f 9 ,. individuals w fth normal pigmoent ation 8 Controlled cross-pollination of all the different colour varieties available, in all
.f / f = individuals with abnormal pigmenta~ion possible combinations, and recording the colou rs shown by the offspring.
- ,.. a 'mating line' C Controlled self-pollination of several individuals of each of the colour varieties and
recording the colours shown by the offspring of each individual plant sampled .
D Surveying large wild populations and finding the ratios of the different colours in
Which one of the following ratios of offspring will be produced when P and Q are bred
these populations.
together?
A 2 females (both normal): 2 males (both abnormal)

23. What happens to most of the reduced nicotinamide adenine dinucleotide (NADH 2 )
B 2 females (both carriers): 2 males (both normal) molecules in cell metabolism?
C 2 females (1 carrier, 1 abnormal): 2 males (1 normal, 1 abnormal)
D 2 females (1 carrier, 1 normal): 2 males (1 normal, 1 abnormal) A Oxidation in the Calvin cycle.
8 Oxidation in mitochondrial ATP formation.
C Combination with succinic acid as part of the Krebs cycle.
21 . The family tree shows the inheritance of a skin condition.
'
D Acting as an oxidising agent for FADH2.
"'
IT~ ".TI
Key:
0 No.rmul man
24. Which of the followi ng statements is true regarding cyclic and non-cyclic
I Arfeclcd mun
Nomi:J.Iwumo.n
photophosphorylation ?
0
A Only non-cyclic photophosphorylation produces ATP .
AJre-ctcd woman
8 In addition to ATP , cyclic photophosphorylation also produces 0 2 and NADPH.
What is the genetic basis of the skin cond ition? C Only cyclic phot9phosphorylation utilizes light at 700 nm.
0 Only cyclic photophosphorylation can operate in the absence of photosystem II.
A autosomal dominant
8 sex-linked dominant
C autosomal recessive
D sex-linked recessive
www.gradtutors.com
13 14
25. Which of the following processes could still occur in a chloroplast in the presence of an 28. Insulin is a hormone involved in the regulation of blood glucose levels. Failure.to produce
inhibitor that prevents W from passing through ATP synthase complexes? insulin results in insulin-dependent diabetes, and people with this condition must have
regular injections of insulin. The effecti veness of two types of insu lin was tested.
1 Sugar synthes is Participants in this test were divided Into two groups. One group received N insulin. The
2 Photolysis of water second group received L insulin. All participants received the same am ount and
3 Transfer of electrons down the electron transport chain concentration of the appropriate insulin.
4 Oxidation of NADPH
The following graph shows the average results for participants in each of the two groups.
A 1&2
B 1&4
c 2& 3
N Insulin
D 3&4
3
I
I
, ........ .
"'
'
/
I ', Llnsulln
glUCOH upiAka by ~Ia 2 I '
26. Many signal transduction pathways use second messengers to I ',
l~glmln)
I
I '
'
l
~
I ',,
'
A transport a signal through the plasma membrane. ...
B relay a signal from the outside to the inside of the cell . I I
I I I
' '~
I -,--=c--rx--,
0 0
C relay a signal from the inside of the membrane throughout the cytoplasm . 2 6 10 12 14 16 18. 20 22 24.
0 amplify the message by phosphorylating proteins. tine ~ lnjeciiQn
(l>oln)
27. Myasthenia gravis is a rare genetic disease found in cats. In juvenile cats with this Which of the following statements is/are true about the effectiveness of the two types of
condition , there is a lack of acetylcholine receptors at the neuromuscular junction. Which insulin?
of the following explains the effect of the lack of such receptors?
1. N insulin needs to be given more frequently than L insulin in a day.
A An inability of acetylcholine to bind with the post-synaptic membrane leading to 2. A dose of N insulin is more effective than L insulin in reducing blood glucose level in
paralysis of the muscle. one day.
B An accumulation of acetylcholine in the synaptic cleft leading to overstimulation of the 3. Using L insulif! may be more advantageous for a person with insulin dependent
muscle. diabetes.
C An accumulation of acetylcholine in the synaptic cleft leading to intermittent response
by the muscle. A 1 only
D An inabil ity of acetylcholine to trigger an action potential at the post-synaptic B 2 only
membrane leading to paralysis of the muscle. c 2&3
D 1& 3
www.gradtutors.com
15 16
29. Which sequence of events correctly describes evolution by natural selection? 31 . The table below shows the amino acid sequence of part of the beta-haemoglobin
molecule found in 6 different vertebrates. The ~-globin chain has a total of 146 amino
Differential reproduction of the spfders occurs. acids. Only the amino acids found in positions 101 to 116 are represented .
n A new selection pressure occurs.
Ill Allele frequencies within the spider population change. Am ino acid positi on 101 102 103 104 lOS 106 107 108 109 110 111 112 113 114 liS 116
IV Poorly adapted spiders have decreased survivorship. Human (H u}

Red Kangaroo (Rf<)
glu
glu
asn
asn
phe
phe
"
lys
leu
leu
leu
leu
gly
gly
asn
asn "'
lie
leu
lie
val
vol
cys
lie
val
cys
leu
leu
ala
ala
his
glu
Rhesus Monkey (RM) glu asn phe lys leu leu gly asn val leu val cys va l leu ala his
A II, IV, 1, 111 Gorilla (G) glu asn phe lys leu leu gly asn val leu val cys va l leu ala his
.B
C
II, IV, Ill , I
IV, I, Ill, II
Chimpanzee (C)
Horse (Ho)
glu
glu
as n
asn
phe
phe ..."' leu
leu
leu
leu
gly
gly
asn
asn
vel
va l
leu
leu
val
ala
cys
leu
vl
val
leu
val
ala
ola
his
"'
0 IV, Ill, I, II
Which of the following phylogenetic trees best matches the data in the table above?
30. The histogram represents the proportions of a population of new-born mammals fa lling AK
~LY
A Ho
into various birth weight classes. The line graph represents mortality. hr-l
B G HuCRKHo
. . . . . I \1[ ~ __.,...
I
of 10 '
. 10 mortality
p~ulation 7 '
5 .., c RK Ho AM G c Hu
/ \. \.
5
0
2 3 4 5 ~ 7 a 9 , 0 11 D Hu c RK Ho G AM
birth weight/ kg
. From the information given, which conclusion is correct?
A Birth weight is undergoing stabilizing selection

B Birth weight is an example of discontinuous variation
C Birth weight is genetically linked to mortality
0 Birth weight is dependent on mortality
www.gradtutors.com
17 18
32. Wh ich of the following is an example of mechanical isolation? 35. A gene codi ng for the production of a human gene product was inserted into a plasmid
with genes coding for resistance to antibiotics ampicillin, streptomycin and tetracycline.
A Two species of frogs have different mating calls. The plasmids were used to transform E. coli and the bacteria ~:~rown on a nutrient
B The fiower structure of one species prevents the transfer of pollen from another medium. The resulting master plate is shown in the diagram.
species.
C Two species of birds live in the same habitat; one mates in spring and the other in
summer.
D One species of lizards inhabits the trees, and another specie~ inhabits the ground
cover.
33. Which of the following is not a difference between a genomic and a eDNA library of an Transformed cells were selected by replica plating the bacteria colonies onto media
organism? containing vari ous antibiotics.
Gen omic library eDNA library Which plate contains the colony of bacteria into which the human gene has been
A Contains all the genomic DNA of an Contains some of the mRNA of an suce~sfully inserted? '\
organism organism
B Includes all active and inactive Includes only active genes A 8
genes
c Procedure includes the use Procedure does not require the use
restriction enzymes to digest DNA of restriction enzymes to digest
DNA
D Useful for organisms with small Useful for organisms with large
genome sizes genome sizes
medium wllh arnplclllln medium wUh the antibiotic

and atreplomycio kallalllycln
34. Which of the following are limitations/disadvantages of the polymerase cha in reaction? c D
High sensitivity to contamination from non-template DNA

2 Degradation of DNA which is subjected to repeated thermal cycling
3 Limited maximum length of fragment which can be amplified
4 Lack of proof-reading in Taq polymerase resulting in frequent mutations
A 3 and 4
modlum .,.;111 amp!Gilio, mllurn wHh tetrocyWrle
B 1, 2, and 4 streptomycin and tetracycline
C 1, 3, and 4
D All of the above
www.gradtutors.com
19 20
36. Nine skeletons were found in an unidentified grave, belonging to 3 children and 4 adults. 37. The following diagram shows a plasmid which is used for genetic engineering purposes.
To establish the relationship between .these nine individuals, small amounts of DNA were
isolated from the skeletons, and PCR. was carried out. Genetic fingerprinting was then
carried out on the amplified DNA, and the results from the genetic fingerprinting
-
experiment are shown in the chart below.
!!:!"d..:j . lliMJ I ~ I &!!!iJ I '"'"' J I ,IJ!!ILI I ~i'!!t!.;!

'I ---
A eukaryotic gene is inserted in the plasm id. Which of the following is true of bacteria
cel ls transformed with this recombinant plasmid?
1 Survive on ampicillin-containing medium

2 X-gal is hydrolysed
3 Multiple copies of the same plasmid in the cell
4 One copy of the plasmid in the cell
A 1 and 2
All three children on the chart had the same parents. Which of the following correctly
8 1 and 3
identifies the children's parents?
C 2 and 3
D 1, 2 and 4
f- Adults 1 and 2
,
B Adults 1 and 3
C Adults 2 and 4
38. To determine the range of cell types which could be produced from a single
D Adults 2 and 3
hematopoietic stem cell , Investigator Sala-Chen suggested using a retrovirus which
carried a gene encoding a green-fluorescent protein (a marker gene). The rationale
beh ind his suggestion is
A retroviruses will jnject their genomes into the cell , which can then move to the
nucleus to be expressed.
8 retroviruses will cause the genome of the stem cell to disintegrate and synthesize its
viral material which will be passed on to new cells as it divides.
C retroviruses wil l insert their genome into the chromosomes of the infected cell, and as
the cell divides, it is possible to trace all the progeny of the cell.
D retroviruses will replace the eq uivalent of the marker gene in the stem cell through
genetic recombination, causing all progeny produced by the stem cell to carry a copy
of the marKer gene.
www.gradtutors.com
21
Questions 39 and 40 refer to the following information.
In order to engineer a crop plant with protection against infestation by insects, scientists
have transformed a strain of corn using a cloning vector carrying the following genes:
a gene encoding a toxin from the bacteria Bacillus thuringiensis wh ich is

poisonous to insects.
a 'pat'-gene which confers tolerance to the herbicide ' Bas!a'.
an 'amp'-gene which confers resistance to the antibiotic ampicillin.
There is concern that the 'amp' gene may transfer to enterobacteria in the human intesti ne
during nucleic acid digestion, making treatment with ampici llin ineffective for diseases
caused by enterobacteria.
39. What is the function of the 'pat'-gene on the cloning vector? \
A Enables farmers to decrease the cost of producing corn , by allowing the widespread
remove weeds.
application of herbicide 'Basta' to
8 Enables corn plants to grow healthier, resulting in higher yield of corn .
C Enables plants to be resistant to chemicals produced by insects.
D Enables the selection of plants with the Bt toxi n gene.
40. Which of the following statements explains why the transfer of this gene from the plant to
bacteria in the human intestine is unlikely?
A An orig in of replication and appropriate prokaryotic promoters are required for the
expression of the 'amp' gene.
B Bacteria cannot take up any DNA released during digestion of the plants by human
nuclease enzymes without a vector.
C 50% of the enterobacteria isolated from humans are already '.amp' resistant.
D All plant DNA is digested and destroyed in the human intestine during digestion of
plant cells by enzymes including human nuclease enzymes.
www.gradtutors.com
/
CANDIDATE NAME (CG) - - - - - - - - - - INDEX NUMBER _ _ __

BIOLOGY Paper 2 (Core)- 9648/9747

Higher 2
Monday
16 August 2010
2 hours
Additional materials: Answer paper
READ THESE INSTRUCTIONS FIRST

Write your name and index number in the spaces at the top of this page and on all the
work you hand in. /
Write in dark blue or black pen.
You may use a soft pencil for any diagrams, graphs orrough working .
Do not use staples, paper clips, highlighters, glue or correction fluid.
Answer all questions in Section A and only one question in

Section B ..
Write your answers in spaces provided on the question paper. Section B
1 /12
At the end of examination, 2 /12
1. fasten all your work securely together;
3 /10
4 /12
INFORMATION FOR CANDIDATES 5 /11
The intended number of marks is given in brackets [ ] at the
end of each question or part question. 6
7
Section B
8 /20
9 /20
TOTAL /100
www.gradtutors.com
Section A (80 marks)
Answer all questions in the space provided
Question 1
The figure below shows an electron micrograph of a eukaryotic cell.
(a) Label the structures A, B, D, and E. [2]
www.gradtutors.com
/
(b) List two main functions of structure F. [2]
(c) (i) The primary structural component of G is known to be a polysaccharide. Name the
monomer of this polysaccharide. [1]
(ii) In the space below, draw a labeled diagram to show how two such monomers are joined
together. [2]
(d) In addition to DNA, a second common biological polymer is known to make up a large
proportion of structure C. Contrast this polymer with the polysaccharide found in G. [3]
www.gradtutors.com
/
A meristem is the tissue in all plants consisting of undifferentiated cells (meristematic cells) and
found in zones of the plant where growth can take place. Meristematic cells are analogous in
function to stem cells in animals, are incompletely or not at all differentiated, and are capable of
continued cellular division.
(e) Name one organelle not found in the figure which is likely to be present in meristematic
cells, and briefly explain your answer. [1]
(f) State which of the organelles found in the figure is not likely to be pres_eJJt in meristematic
cells. [1]
/
... ... .. .. .... ... .. .... ...... . . .. .... . . ... ....... ...........
./.. . .. ... .. .. ........... .. .. ... .... ................... .... ....... .
[Total: 12 marks]
www.gradtutors.com
/
Question 2
In the polymerase chain reaction, thermal cycling of reaction mixtures containing the heat
resistant Taq polymerase is performed to amplify specific DNA fragments from a template. A Taq
polymerase is an example of a DNA polymerase, which are enzymes that catalyze the
polymerization of deoxyribonucleotides into a DNA strand.
(a) Describe the specific reaction which is catalyzed by DNA polymerases. [2]
0 0. 0 0 0 0 0 .... . 0 0 0 _ , _ : ....... . ... .. .
(b) State three ways in which en.zymes may lower the activation energy of the reactions they
catalyze. [3]
.... ..... ..... .. ......-............................................... ... ...... ............. . ........................ .
(c) Suggest possible differences in the structure of Taq polymerase which make it tolerant of
much higher temperatures than typical eukaryotic polymerases. [2]
www.gradtutors.com
/
[EI~~1o"&rg~fii~If&Q'iiJgo't1n(lriJ:\~l~ni)~:fi1. are known to affect the rate of DNA a-mplification by

Taq polymerase. An experiment was conducted to determine the effect of X andY on the
rate of strand extension by Taq polymerase under different initial dNTP concentrations.
The results of the experiment are presented in the table below.
Rt f b . I
0 2x1o6 6x10-6 2x1 o-s 6x1o-s 2x10-4 2x10-3
dNTP
mol/dm molldm mol/dm mol/dm mol/dm mol/dm mol!dm
concentration 3 3 3 3 3 3 3
0 mo1/d m X
'
2.5x104 0 0 0 0 0 0 0
3
mol/dm Y
0 mol/dm" X,
0 0 0 0 0 0 0
0 mol/dm3 Y
2.5x10"
- -
mol/dm 3 X,
0 3 5 15 28 40. 50
2.5x104
mol/dm 3 Y
2.5x10 4 /
ri1ol/dm 3 X, 0 Js 15 35 45 50 50
0 mol/dm 3 Y
Based on the results above, answer the following questions:
(d) Describe and explain the effect that compounds X andY have on the rate of nucleotide
extension. [X: 2 marks, Y: 3 marks].
.. ~ .. . . . . - . . . . . . . . . . . . . . . . :. ..... . ... ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . ~ !' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
[Total: 12 marks]
www.gradtutors.com
Question 3
If a pure line wheat plant with a colored kernel (genotype = AABB) is crossed to plant
with white kernels (genotype= aabb) and the resulting F 1 plants are selfed, a 15 coloured
:1 white phenotypic ratio is obtained in the F2 offspring.
(a) Illustrate this cross in the space below. [5] .
www.gradtutors.com
/
(b) Explain, using suggested biochemical principles, why the 9:3:3:1 ratio is not
obtained in the F2 generation. [3]
/
... .. ... .. .. .. .. ......... ...... ............ . . .. ....................................................................... .
_
Manx cats are heterozygous for a gene that controls tail length. Manx cats have no tails,
larg e hind legs, and a distinctive gait. The mating of two Manx cats yields two Manx
kittens for each normal, long-tailed kitten, rather than three-to-one ratio that would be
predicted from Mendelian genetics. Suggest why this is so. [2]
[total: 10 marks]
www.gradtutors.com
/
Question 4
In 1951 , Joshua Lederberg and Norton Zinder were testing for recombination in the bacterium
Salmonella typhimurium. The researchers used two different strains of bacteria: one which only
grew when supplied with tryptophan and tyrosine, and a second strain which only grew when
supplied with methionine and histidine. When either strain was plated on a minimal medium, no
wild-type cells were observed. However, after the two strains were mixed, wild-type cells
appeared at a frequency of about 1 in 105.
(a) How does genetic recombination typically occur in eukaryotes? [2]
(b) List three methods by which genetic recombination may occur in bacteria. [2]
In a further U-tube experiment, the different strains were placed in different arms of a U-tube, and
sep, !dtcd by a filter preventing cell contact. In this experiment, recombinant strains could also be
obtamed. By varying the size of the pores in the filter, they found that the agent responsible for
recombination was about the size of the virus P22, a known temperate phage of Salmonella .
(c) Explain the meaning of the phrase "temperate phage". [1]
www.gradtutors.com
./
(d) Briefly outline the process by which a lytic bacteriophage like the T4 phage causes
recombination between bacteria. [3]
10
www.gradtutors.com
During replication, the circular genome of P22 initially undergoes rolling-circle replication, which
produces a long continuous DNA molecule consisting of multiple copies of the phage genome.
The DNA is packaged into phage heads by a "headful" mechanism: following the assembly of the
virus procapsid, packaging is initiated at a specific sequence on the DNA called a pac site, and
the DNA is cut after a length of 48 kbases. This assembly process leading to the assembled
bacteriophage is shown in the figure below.
/1
,sCaffold
core
1' J ~
..'\c'lw.f&
~--- -a
-c .." ..-
.."~~. .;~~-
a ~
~
'. .
3
c--
~ . .1*1.; ."'-0 g:: ...ra..::: ~o:'. . . . .. . . . .
"./.sfie\'" "Q&~o\.<>
t
portal \' termin<~se '

'
Procapsid
( l
(e)
'
Infectious
Phage
Compare and contrast the structure of the assembled bacteriophage P22 with the human
influenza virus. [4]
[Total: 12 marks]
11
www.gradtutors.com
/
Question 5
Figure 5.1 shows the effect of the puffer fi~h toxin on various human nervous impulse parameters.
Fwt().~
i I
Con:r(I!
l~tl~
P'vJ[If!'ff$11
~~~til'!9
2:
Figure 5.1
(a) Describe how a nervous impulse may be generated in a human neuron. [3]
12
www.gradtutors.com
,/
(b) Using the information from Figure 5.1, discuss how the puffer fish toxin may affect nerve
actM~ . ~
(c) Based on the data provided, suggest what the symptom of puffer fish poisoning may be.
[1]
13
www.gradtutors.com
/
Figure 5.2 shows a type of cellular receptor called an integrin. lntegrins are found-on a wide
variety of cell types and are able to bind with ligands such as collagen~
Copyright ll:l2009 Pearson Education, Inc.
Figure 5.2
(d)(i) Describe how the integrin receptor may respond to the binding of a ligand. [2]
(ii) lntegrin receptors are not known to have kinases associated with them. Suggest a
possible problem this might present to the cell signaling pathway. [1]
[Total: 11 marks]
14
www.gradtutors.com
/
Question 6
Figure 6.1 illustrates the movement of electrons through certain eukaryotic organelles.
enzyme
Electron Tran
Figure 6.1
(a) Name two eukaryotic organelles that contain an electron transport chain similar to the one
shown in Figure 6.1. [2]
(b) Using a named example, explain how the electron transport chain allows the organelle
containing it to achieve its function. [5]
.............................................................................................................................
15
www.gradtutors.com
/
(c) Certain organisms are able to survive in the absence ofoxygen. Describe the way that
two named organisms obtain the energy for survival in the absence of oxygen. [4]
[Total: 11 marks]
16
www.gradtutors.com
/
Question 7
Sickle-cell anaemia is a genetic blood disorder characterized by red blood cells that assume an
abnormal, rigid, sickle shape. Life expectancy is shortened, with studies reporting an average life
expectancy of 42 in males and 48 in females.
The gene defect is a known mutation of a single nucleotide, which results in glutamate being
substituted by valine at position 6. The genetic disorder is due to the mutation of a single
nucleotide, from a GAG to GTG codon mutation. In conditions of normal oxygen concentration,
the mutation causes no apparent effects on the secondary, tertiary, or quaternary structure of
haemoglobin. However, under conditions of low oxygen concentration, the deoxygenated form of
haemoglobin exposes a hydrophobic patch on the protein, which the hydrophobic residues of the
valine at position 6 of the beta chain in the sickle-cell haemoglobin are able to associate with,
causing molecules of haemoglobin S molecules to aggregate and form fibrous precipitates.
(a) Explain the meaning of "selection pressure". [1]
(b) Compare the relative biological fitness of an individual which is homozygous for the HbS
allele and an individual which is homozygous dominant for HbA. [1]
In areas where malaria is common, those with only one of the two alleles of the sickle-cell
haemoglobin are more resistant to malaria, since the infestation of the malaria parasite is halted
by the sickling of the cells which it infests. When within the erythrocyte, the parasite produces a
group of enzymes known as plasmepsins, which are aspartic proteases used to degrade
haemoglobin. Some of the amino acids produced by the hydrolysis are then utilized in the
synthesis of parasite protein.
(c) Suggest why the parasitic infection of the red blood cells is Jess effective in individuals
who carry a single copy of the HbS allele. [2]
.............................................................................................................................
17
www.gradtutors.com
/
(d) In areas where malaria is common, explain the expected changes in frequency ofthe
HbS allele in a population's gene pool over successive generations as a result of natural
selection. [3]
..............................................................................................................................
........................................................................................................ .- ....................
.......... .............. ... .......... .........................................................................................
In an investigation designed to assess the possibility of using RFLPs to screen for sickle cell
anaemia, it was determined that the HbS allele was frequently associated with a 13kb restriction
fragment, associated with the loss oJ a hpal restriction site adjacent to the haemoglobin gene
locus, caused by the insertion of several nucleotides within the restriction site.
The insertion mutation in the hpal restriction site is known to be selectively neutral. The neutral
theory of evolution proposes that changes in the frequency of most selectively neutral alleles in a
population's gene pool are caused by the process of genetic drift.
(e) Explain the meaning of the phrase "selectively neutral". [1]
(f) Briefly describe the process of genetic drift. [2]
(g) Explain whether the high frequency of individuals with the HbS allele in regions of where
malaria is common is caused by genetic drift. [2]
[Total: 12 marks]
18
www.gradtutors.com
/
Section B (20 marks)
Answer one question.
Write your answers on the separate answer paper provided.
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate,
Question 8
(a) With the aid of labeled diagrams, describe the changes within the cell associated with the
different stages of mitosis. [10]
(b) Compare and contrast the changes described in the section above with those associated
with the different stages of meiosis I. [6]
(c) Explain the importance of mei9sis to sexually reproducing organisms. [4]
Question 9
(a) Describe the function of telomeres in eukaryotic cells undergoing DNA replication. [8]
(b) Describe the function of telomerase and explain why its expression is necessary in a
named cell type in the human body. [8]
(c) Name and briefly describe the functions of two other non-coding sequences required in
the control of gene expression in eukaryotes. [4]
19
www.gradtutors.com
/
BLANK PAGE
20
www.gradtutors.com
/
CANDIDATE NAME (CG) - - - - - - - - - INDEX NUMBER _ _ __

BIOLOGY Paper 3 (Applications)- 9648 -

Higher 2
Tuesday
24 August 2010
2 hours

Write your name and index number in the spaces at the top of this page and on all the work you
.hand in.
You may use a soft pencil for any diagrams, graphs or rough working.
Do not use staples, paper clips, highlighters, glue or correction fluid .
Answer all questions.

Write your answers in spaces provided on the question paper.
Section A
At the end of examination, --
1. fasten all your work securely together; 1
-
2
-
INFORMATION FOR CANDIDATES 3
The intended number of marks is given in brackets [ ] at the end of Section B
each question or part question.
4 I /20
c
5 /12
TOTAL I /72
This question paper consists of 14 printed pages.
www.gradtutors.com
/
Section A (40m)
Question 1
The Fas receptor gene (Fas) is a tumour suppressor gene that encodes a
transmembrane receptor protein. On binding to an extra-cellular ligand, the receptor
trimerizes and is internalized into the cytoplasm of the cell, where it initiates a variety of
proteolytic pathways which eventually result in DNA degradation, membrane blebbing,
and other hallmarks of apoptosis.
(a) Explain the term "tumour suppressor gene". [1]
The organization of the Fas gene i~ shown in the diagram below:
-Pl
l ntron 1 ln t ron 2 lnt r on 3 ln t r o n 4 l ntr on 5 l ntron 6 lnt r on 7 l n t ron 8

-
P2
12kb 4 .Skb lk b t.Skb 0 .2kb 1.1 kb 1.2kb O.Skb
+ - - - - - Extrocellu la.r r e gi o n _ _ _ _ __,. +- l n tri! ~ell ular r~gJ o n -
Transmembran e r egi on
Using mRNA from normal epithelial cells (E1) and cells from two different skin cancers
identified as deficient in Fas function (S 1 and S2), reverse transcription was carried out.
Subsequently, PCR was performed on the products of reverse transcription using
rimers P1 and P2, which are specific to the exon regions as shown in the diagram
above.
www.gradtutors.com
The PCR products were separated on an agarose gel and the results are shown in the
gel image below.
El Sl 52 Ladder
lOOObp
900bp
(937bp)
800bp
700bp
600bp
SOObp
(a) Explain why reverse transcription of mRNA was carried out prior to the PCR reaction.
[2]
(b) Briefly explain why DNA fragments are separated by size when run in an agarose
gel. [2]
www.gradtutors.com
/
(c) Deduce th e size of the fragment from the normal epithelial cell. [1]
(d) Explain the significance of the PCR results obtained from S1 and S2. [4]
In a subsequent experiment, a Southern blot was performed using the mRNA from
sample S2, using a 200-nucleotide hybridization probe corresponding to sequences
from exons 2 and 3. In this experiment, a fragment of approximately 670 bases was
detected.
(e) Using information from Figures 1.1 and 1.2 above, explain the results of the
Southern blotting experiment. [2]
www.gradtutors.com
[s>pew g~]
[8] sueo snoJeoueo Lll!M pele!oosse Aluowwoo seJnleeJ

J94l0 ~eJLjl eweu '(S!SO}dode) 4l89p IJ90 pewweJ60Jd JO UO!SS/\9 Ol UO!l!PP8 Ul {J)
www.gradtutors.com
/
Question 2
In the process of cloning a eukaryotic gene in a prokaryotic host, plasmids carrying selectable
markers are often utilized as cloning vectors. A suitable cloning vector may be made from the
two plasmids shown in the diagram below.
fcoJil si{
~----..!.1 . e
pAMP plac
4529bp 4823bp
~:lua3. _,dwe
1. .. .
orig_ins ~f r_e pl i_ca-tjon
~
Both pAMP and pLac are known to contain BamHl and EcoRl restriction sites and an origin of
replication each. The key difference is that pAMP contains the ampicillin resistance gene while
pLac contains the LacZ gene.
To form the desired cloning vector, both pAMP and pLac are treated with a mixture of restriction
enzymes , namely BamBI and EcoRl. The restriction fragments obtained are allowed to ligate to
form several possibilities of circular plasmid, which can then be separated using electrophoresis
to obtain the desired product.
(a) In the space below, draw and annotate the desired product formed from the two plasmids. [2]
www.gradtutors.com
(b) Explain the function of the selectable marker genes found on cloning vectors. [2]
~ .. .... ... .. . .. .. .................... . ..... 0 ....... . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....................... i ................................................................ .
(c) Name the protein product of the LacZ gene, and describe how it is used as a selectable
marker. [3]
... .......... ....................................... ........... :..... ............................................................................................ .
www.gradtutors.com
/
A student attempts to clone a gene of interest into the recombinant plasmid obtamed from step (a)
above. As the gene of interest is known to be flanked by EcoRl restriction sites, he first
amplifies copies of the gene via PCR, and then incubates both the plasmid and the PCR product
with restriction enzyme EcoRl for an hour before mixing the reaction mixtures together for
ligation;
{d) Explain the problem with the student's procedure, and suggest a possible improvement to..the
procedure. [3]
~ " o o o ou oc c o o DO o o o o o oo o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o oo oo o o oo o o o oo o o o oo oo o o o o oo o o o o o o o o o o o o o o oo o o o o ,.-,. o-ri"o o o oo o o o o oo o o o o o o o o ooo o o o o o
... ........................................................................................................................................................
/
[Total: 10 marks]
www.gradtutors.com
Question 3
By 1999, genetically modified maize plants replaced non-genetically modified maize plants as
the more widely grown crop in the USA. One of the transgenic varieties of maize contains a
gene (Bt) from a bacterium, Bacillus thuringensis. The gene codes for a toxin, which is
expressed in the leaves and acts as an insecticide.
(a) Explain
(i) what is meant by a transgenic variety of maize. [3]
'
(ii) why farmers in the USA grow maize carrying the Bt gene. [2]
(iii) Maize is a monocotyledonous plant which Agrobacterium would not infect. Suggest one
method by which the Bt gene can be introduced into the plant. [1]
www.gradtutors.com
The Bt gene is also expressed in pollen, which may be dispersed by wind, at least 60m away
from the parent plant. In the USA, milkweed frequently grows around the edge of maize fields
and is fed upon by caterpillars of the Monarch butterfly.
In an experiment conducted to investigate the environmental effects of Bt maize, leaves of the

milkweed were divided into three groups, A, 8 and C, and treated in the following ways:
A : dusted with pollen from genetically modified maize carrying the Bt gene;
8: dusted with pollen from maize that had not been genetically modified;
C : not dusted with pollen.
Monarch caterpillars were then placed on the leaves and the mean area of leaf eaten per
caterpillar and the survival of the caterpillars was measured over four days. The results of the
investigation are shown in Fig . 3.1 and 3.2.
t , B ~----.-----r--~............
1.s ...............~--+-~-----4----~-xc
/
14
.+---~.........r----+------l...-1
/
m&anarea . ./
of leaf ,eaten 1.2 + - - - - - - t - -- --t---:o,,.;...;_--1 B
per.caterpil~/ . .o.. ..~ "
arbitrary unrts 1. ,
0.8t-----+------~.....;_--,,.cL"- "- ---t ,..~ ;;
,or"" ~
0.6+--- - - +- ..~
... -_......
. ,.;..-- -,-i
.. 1-/~.'-/
-~ A
o.4 .... ~
.,.. +. . _,.. ... .,
_..V
0.2 ... _.. ~ -
. . . ~ -r~~ ~
0 'f-.-- ---t-- - --+----.........

day 1 day 2 day 3 day 4
%
survival
of 60
caterpillars .A
key
fillB
oc
Figure 3.2
10
www.gradtutors.com
/
(b) With reference to Figs. '3.1 and 3.2,
(i) comment on the effect of consuming pollen from genetically modified maize carrying the
Bt gene on the mean area of leaf eaten per caterpillar. [4]
............................................................................................................................................................
-'
(ii) compare the effect of consuming pollen from different maize plants on the survival of
Monarch butterfly caterpillars. [2]
11
www.gradtutors.com
/
In the USA, 50% of the summer population of Monarch butterflies is found in the maize-growing
area . Maize pollen is shed between late June and the middle of August, which is during the
period when Monarch caterpillars are feeding.
(c) Using only information given in this question, predict with reasons, the effect of continued
cultivation of Bt maize in the USA on the population of Monarch butterflies. [3]
.................................................. ... .......................................................................................................
[Total: 15 marks]
12
www.gradtutors.com
Section B (20 marks)
Write your answer on the separate answer paper provided.
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Question 4
(a) Explain, with examples, what is meant by gene therapy and discuss its ethical
implications in humans. [1 0]
(b) Compare the mutations responsible for cystic fibrosis (CF), X-linked and ADA-
deficient severe combined immunodeficiency (SCID) and ~_<?mment on their pattern
of inheritance. [6]
.(c) Explain how embryonic stem cells could potentially be manipulated for therapeutic
applications. _. [4]
13
www.gradtutors.com
/
Section C (12 marks)
Question 5
There is currently a controversy regarding an individual named Clay Molten. His mother,
Pauline Adios, is unsure as to the true identity of his father. She believes the father -
could be either Simon Cook or Doggy Jackson. Due to the high profile of the two
potential fathers within the world of showbusiness, this case has been covered at length
by the media. A district court has decided to put an end to the media circus by
determining the identity of the father once and for all.
As the main researcher in a leading life science institute, you have been approached to
help out in this case. Plan an investigation using RFLP analyses to confirm the identity
of Clay Molten's father.
Your planning must be based on the assumption that you have been provided with the
following equipment and materials:
., DNA samples from the Clay Molten, Pauline Adios, Simon Cook and Doggy Jackson
., PCR machine
Appropriate buffer solutions
Microcentrifuge tubes
Restriction enzymes
Agarose or Polyacrylamide gel plate
Suitable source of electrical current
0 Radioactive probes
> Nitrocellulose membrane
Autoradiography equipment
You are free to propose any other equipment and materials that you feel is necessary.
Your plan should have a clear and helpful structure to include:
~ An explanation of the theory to support your practical procedure.
A description of the method used, including the scientific reasoning behind the
method and any recommended safety measures.
~ The type of data generated by the experiment.
How the results will be analyzed including how the origin of the organism can be
determined.
14
www.gradtutors.com
CANDIDATE NAME (CG) - - - - - - - - - INDEX NUMBER _ _ __

BIOLOGY Paper 3 (Applications)- 9747 -

Higher 2
Tuesday
24 August 2010
1.5 hours

W rite your name and index number in the spaces at the top of this page and on all the work you
hand in.
Answer all questions.

Write your answers in spaces provided on the question paper.
Section A
At the end of examination,
1. fasten all your work securely together; 1
-
2
-
INFORMATION FOR CANDIDATES 3
The intended number of marks is given in brackets [ ] at the end of Section B
4 /20
TOTAL I /65
www.gradtutors.com
/
Section A (40m)
Question 1
The Fas receptor gene (Fas) is a tumour suppressor gene that encodes a
transmembrane receptor protein. On binding to an extra-cellular ligand, the receptor
trimerizes and is internalized into the cytoplasm of the cell, where it initiates a variety of
proteolytic pathways which eventually result in DNA degradation, membrane blebbing,
and other hallmarks of apoptosis.
(a) Explain the term "tumour suppressor gene". [1]
-
The organization of the Fas gene ip shown in the diagram below:
Pl P2
+---
lnt ron 1 lntron 2 lntron 3 ln tron 4 lntron 5 lntron 6 lntron 7 lntron 8

12kb 4.5kb lkb l.Skb 0 .2kb l.lkb 1.2kb O.Skb
+------- Extracellular region----~ - Intracellular region -
Transmembrane 1egion
Using mRNA from normal epithelial cells (E1) and cells from two different skin cancers
identified as deficient in Fas function {S1 and S2), reverse transcription was carried out.
rimers P1 and P2, which are specific to the exon regions as shown in the diagram
above.
www.gradtutors.com
/
gei image below.
El 51 52 Ladder
lOOObp
900bp
(937bp)
800bp
700bp
600bp
SOObp
(a) Explain why reverse transcription of mRNA was carried out prior to the PCR reaction.
[2]
(b) Briefly explain why DNA fragments are separated by size when run in an agarose
gel. [2]
www.gradtutors.com
/
(c) Deduce the size of the fragment from the normal epithelial cell. [1]
i
.. . 0 ~ 0 0 ~ 0 ... 0 0 . " 0 .. . 0 0 0 0 0 0 0 0 0 0 0 0 0 0. 0. 0 0 0 0 0 0
in a subsequent experiment, a Southern blot was performed using the mRNA from
sample S2, using a 200-nucleotide hybridization probe corresponding to sequences
detected.
(e) Using information from Figures 1.1 and 1.2 above, explain the results of the
Southern blotting experiment. [2]
www.gradtutors.com
(f) In addition to evasion of programmed cell death (apoptosis), name three other
features commonly associated with cancerous cells. [3]
[15 marks]
www.gradtutors.com
/
Question 2
In the process of cloning a eukaryotic gene in a prokaryotic host; plasmids carrying selectable
markers are often utilized as cloning vectors. A suitable cloning vector may be made from the
two plasmids shown in the diagram below.
pAMP pLac
4529bp 4823bp
vuv! ,dwe
\~r igi nS Of repli ~_a tion
~
Both pAMP and pLac are known to contain BamHl and EcoRl restriction sites and an origin of
replication each. The key difference is that pAMP contains the ampicillin resistance gene while
pLac contains the LacZ gene.
To form the desired cloning vector, both pAMP and pLac are treated with a mixture of restriction
enzymes, namely BamHl and EcoRl. The restriction fragments obtained are allowed to ligate to
form several possibilities of circular plasmid, which can then be separated using electrophoresis
to obtain the desired product.
(a) In the space below, draw and annotate the desired product formed from the two plasmids. [2]
www.gradtutors.com
(b) State the source and natural function of restriction enzymes. [1]
(c) Explain the function of the selectable marker genes found on cloning vectors. [2]
(d) Name the protein product of the LacZ gene, and describe how it is used as a selectable
marker. [3] "
www.gradtutors.com
/
A student attempts to clone a gene of interest into the recombinant plasmid obtained from step (a)
above. As the gene of interest is known to be flanked by EcoRl .restriction sites, he first
with restriction enzyme EcoRl for an hour before mixing the reaction mixtures together for
ligation.
(e) Explain the problem with the student's procedure, and suggest a possible iniprovement to_the
procedure. [3]
. .. . . ...... .. .. . . .. ~ ......:- 0
..........................................................................................................................................................
/
(f) State one additional feature the recombinant plasmid must possess before it can be used as an
expression vector for the inserted gene. [ 1]
(g) What are the possible problems faced when expressing a eukaryotic protein in E. coil? [3]
............................................................................................................................................ ...............
[Total: 15 marks]
www.gradtutors.com
/
Question 3
gene (Bt) from a bacterium, Bacillus thuringensis. The gene codes for a toxin, which is
expressed in the leaves and acts as an insecticide.
(a) Explain
(i) what is meant by a transgenic variety of maize. [3]
'
(ii) why farmers in the USA grow maize carrying the Bt gene. [2]
method by which the Bt gene can be introduced into the plant. [1]
www.gradtutors.com
-
The Bt gene is also expressed in pollen, which may be dispersed by wind, at least 60maway
from the parent plant. In the USA, milkweed frequently grows around the edge of maize fields
In an experiment conducted to investigate the environmental effects of Bt maize, leaves of the

milkweed were divided into three groups, A, B and C, and treated in the following ways:
B : dusted with pollen from maize that had not been genetically modified;
C: not dusted with pollen.
Monarch caterpillars were then placed on the leaves and the mean area of leaf eaten per
caterpillar and the survival of the caterpillars was measured over four days. The results of the
investigation are shown in Fig. 3.1 and 3.2.
1.8 ..,------.----r--~~""'l
1.s +-----r---- -+----.........-c
/
14 I
.r-------~--------4---~_.~
meanarea . .
of leaf '~aten 1.2 +--- - - + -- -- .f-- .~.'..;_..----!
=~i~~~~~ 1.0 / I ,/ B
/' ,'
0.8+ - - ---t-- - - -..._- jot.
-r.-'----.--.4
.,
~rr ,
0.6+---- - + -.. . . . .,. . .:. - - h-''-;- ---:1.
.... -- ~~~( /A
__ . ._ -~ . . ~
o.4 ..- .~ V
0~2
.. -_- ___....,...-------
~_
... _~_
0 +=~-----+------'--~------4
~
day i day 2 day3 day4
%
survival
of
caterpillars
60
.A
k.ey
lli11 B
oc
Figure 3.2
10
www.gradtutors.com
(b) With reference to Figs. 3.1 and 3.2,
(i) comment on the effect of consuming pollen from genetically modified maize carrying the
Bt gene on the mean area of leaf eaten per caterpillar. [4]
(ii) compare the effect of consuming pollen from different maize plants on the survival of
11
www.gradtutors.com
/
-
In the USA, 50% of the summer population of Monarch butterflies is found in the maize-growing
period when Monarch caterpillars are feeding.
cultivation of Bt maize in the USA on the population of Monarch butterflies. [3]
[Total: 15 marks]
12
www.gradtutors.com
Section 8 (20 marks)
Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
Question 4
(a) Explain, with examples, what is meant by gene therapy and discuss its ethical
implications in humans. [1 0]
(b) Compare the mutations responsible for cystic fibrosis (CF), X-linked and ADA-
deficient severe combined immunodeficiency (SCID) and ~pmment on their pattern
of inheritance. [6]
{c) Explain how embryonic stem cells could potentially be manipulated for therapeutic
applications. / [4]
13
www.gradtutors.com
Answers to SRJC H2 Biology Prelims Paper 1 Section A (80 marks)

1 D
Q1.
2 B
3 B
4 8
5 D
6 8
7 c
8 c
9 B
10 c
11 B
12 D
13 B
14 B
15 B
16 c
17 c
18 D
19 B
20 D
21 c
22 c
23 B
24 D (a) Label the structures A, B, 0 , and E. [2]
25 c (1/2 ea] A: Vacuole, B: Nucleus/nucleoplasm, D:
26 c ChloroplasUthylakoid/intergranallamallae, E: Mitochondrion
27 A
28 D (b) List two main functions of structure F. [2]
29 A Compartmentalisation of cells to provide different local environments for
30 A different biochemical pathways.
31 c Acts as a ~electively permeable for regulating the passage of substances
32 B In and out' of the cells.
33 c
34 c (c) (i) The primary structural. component of G is known to be a polysaccharide.
! 35 A Name t~e monomer of this polysaccharide. (1]
36 B [1 mar~] IJgl ucose
37 B
38 c (ii) In the space below, draw a labeled diagram to show how two such
39 8 monomers are joined together. [2]
40 D Correct orientation of 13-glucose [1]
Label of 13 (14) glycosidic bond [1/2], label of H20 [1/2]
www.gradtutors.com
02. In the polymerase chain reaction, thermal cycling of reaction mixtures containing
the heat resistant Taq polymerase is performed to amplify specific DNA fragments
(d) In addition to DNA, a second common biological polymer is known to make up from a template. A Taq polymerase is an example of a DNA polymerase, which
a large proportion of structure C. Contrast this polymer with the polysaccharide are enzymes that catalyze the polymerization of deoxyribonucleotides into a DNA
found in G. [3] strand.
(a) Describe the specific reaction which is catalyzed by DNA polymerases. [2]
Monomers of amino acids
Held together by peptide bonds Formation of phosphodiester bond
Helical secondary structures likely to be present Between 3' hydroxyl group of DNA strand and the phosphate group of a
Tertiary and quaternary structures stabilized by a variety of different free nucleotide.
bonds Condensation reaction.
AVP
(b) State three ways in which enzymes may lower the activation energy of the
A .merlstem is the tissue in all plants consisting of undifferentiated cells reactions they catalyze. [3]
(l'rieristematic cells) and found in zones of the plant where growth can take place. Help to orientate reactants to Increase chance of reaction.
Meristematic cells are analogous in function to stem cells in animals, are Slight distortion of bonds In the reactant to Increase chances of breaking
ineompletely or not at all differentiated, and are capable of continued cellular Expose bonds within the reactant to attack.
division (youthful) Creation of a water-free zone in which non-polar reactants may react
(e) Name one organelle not found in the figure which is likely to be present in more easily.
meristematic cells, and briefly explain your answer. [1) Charged residues facilitate the transfer of electrons to and from
RER'or Golgi Apparatus. Synthesis of proteins for cell growth. reactants.
(f) State which of the organelles found in the figure is not likely to be present in (c) Suggest possible differences in the structure of Taq polymerase which make it
meristematic cells. [1] tolerant of much higher temperatures than typical eukaryotic polymerases. [2)
Chloroplast Higher proportion of disulfide bridges.
AVP.
Two inorganic compounds, X andY, are known to affect the rate of DNA
amplification by Taq polymerase. An experiment was conducted to determine the
" effect of X andY on the rate of strand extension by Taq polymerase under
different initial dNTP concentrations. The results of the experiment are presented
in the table below.
www.gradtutors.com
Question 3
Based on the results above, answer the following questions:
=
If a pure line wheat plant with a colored kernel (genotype AABB) is crossed to plant
(d) Describe and explain the effect that compou nds X andY have on the ra te of =
with white kernels (genotype aabb) and the resulting F1 plants are selfed, a 15 coloured
nucleotide extension . [X: 2 marks, Y: 3 marks]. :1 white phenotypic ratio is obtained in the F2 offspring.
(a) Illustrate this cross in the space below. [5)

X is a cofactor [1/2]
Inorganic ion. [1/2] ,
No proper functioning of the enzyme In the absence of X. [1/2]
Quoting data from the table. [1/2] Parental Coloured kernels X white kernels O.Sm
Required for moulding the enzyme Into the correct conformation. [1/2] phenotype
s:
Y Is a competitive Inhibitor. [1/2] Parental AABB X aabb O.Sm
When Y is present, rate of enzyme reaction is lowered [1/2] genotypes:
However, the rate of reaction Is restored at high substrate concentrations. F1 Coloured Kernels O.Sm
[1/2] phenotype
Quote data from the table [1/2] s:
Inhibito r molecule has the same shape as the substrate [1/2] F1 " AaBb '\ o.sm
Competes with substrate for limited enzyme active sites [1/2] _g_eno!YQes ~-
F1 cross: AaBb X AaBb O.Sm '
Parental
gametes X O.Sm
(gametes
circled);
Punnett

Square O.Sm
genotypes;
O.Sm
phenotype
s
F1 Coloured kernels : White kernels O.Sm

phenotype
s
F1 15 : 1 O.Sm
phenotypic
ratio: . -
4 5
www.gradtutors.com
Q4. In 1951, Joshua Lederberg and Norton Zinder were testing for
(b) Explain, using suggested biochemical principles, why the 9:3:3:1 ratio is not recombination in the bacterium Salmonella typhimurium. The researchers used
obtained in the F2 generation. [3] two different strains of bacteria: one which only grew when supplied with
tryptophan and tyrosine, and a second strain which only grew when supplied with
Due to Interaction between the products of the two genes methionine and histidine . When either strain was plated on a minimal medium, no
Epistasis [0.5MJ wild-type cells were observed. However, after the two str.ains were mixed , wild-
Enzyme from either Gene A OR Gene B can produce a product from a common type cells appeared at a frequency of about 1 in 105.
precursor (white). i
In the absence of A orB alleles (Ie. aabb), precursor remains unchanged (a) How does genetic recombination typically occur in eukaryotes? [2)
(white). Genetic recombination occurs due to sexual reproduction [1/2]
AVP Chiasma formation and crossing over In prophase I [1/2]
Independent assortment of alleles in metaphase I [1/2]
Random fusion of gametes [1/2]
Manx cats are heterozygous for a gene that controls tail length. Mahx cats have no tails,
large hind legs, and a distinctive gait. The mating of two Manx cats yields two Manx (b) List three methods by which genetic recombination may occur in bacteria. (2)
kittens for each normal;- long-tailed kitten, rather than three-to-one ratio that would be Transformation, transduction, conjugation. [1 mark for 2, 2 marks for all]
predicted from Mendelian genetics. Suggest why this is so. (2]
In a further U-tube experiment, the different strains were placed in different arms
Homozygous dominant genotype produces the long-tailed kitten. of a U-tube, and separated by a filter preventing cell contact. In this experiment,
Heterozygous = Manx recombinant strains could also be obtained. By varying the size of the pores in the
Homozygous recessive genotype Is lethal. filter, they found that the agent responsible for recombination was about the size
of the virus P22, a known temperate phage of Salmonella.
[Total: 10 marks] (c) Explain the meaning of the phrase "temperate phage". [1]
Bacteriophages which are capable of a lysogenic life cycle (i.e.
Incorporating Its DNA Into the bacterium's DNA and becoming a
prophage).
',
"' (d) Briefiy outline the process by which a lytic bacteriophage like the T4 phage
causes recombination between bacteria. [3]
[1/2 each] A phage enzyme is produced that breaks down the host DNA
into smaller fragments.
Phage DNA is replicated and phage coat proteins are produced.
During assembly of phages, a few phage heads may surround fragments
of bacterial DNA instead of phage DNA.
Phage Is released from host by lysis.
The phage ~ttaches to another bacterium and inject the piece of bacterial
DNA acquired from the first cell.
The bacterial DNA is integrated Into the bacterial chromosome.
6 7
www.gradtutors.com
During replication , the circular genome of P22 initially undergoes rolling-circle Question 5
replication, which produces a long continuous DNA molecule consisting of multiple
copies of the phage genome. The DNA Is packa ged into phage heads by a Figure 5.1 shows the effect of the puffer fish toxin on various human nervous impulse para meter~
"headful" mechanism: following the assembly of the virus procapsid, pa ckaging is
initiated at a specific sequence on the DNA called a pac site, and the DNA is cut
after a length of 48 kbases. This assembly process leading to the assembled
bacteriophage is shown in the figure below.
scaffold
,P J cor~ ~,.,~
~ ~.....
~~~
~.AiA~
. f?.l
~.&ll.~
pohal .:~~:::~ --
Procapsid
r- tennlnase
>
InfectiOus
PhaQe
(e) Compare and contrast the structure of the assembled bacteriophage P22 with
the human influenza virus. [4]
Presence vs absence of envelope.
Presence vs absence of glycoproteins e.g. gp120.
Presence vs absence of a tail structure.
ssRNA genome vs dsDNA genome.
Figure 5.1
(a) Describe how a nervous impulse may be generated in a human neuron. [3]
Inside of axon originally negative compared to outside I ref to resting potential

Depolarlzatiol,l of membrane
Opening of sqdium channels
Influx of sodium Ions
Charge increase above threshold
Charge inside axon becomes positive compared with the outside
Action potential generated
(0.5 marks each]
8 9
www.gradtutors.com
Figure 5.2 shows a type of cellular receptor called an integrin. lntegrins are found on a wide
(b) Using the information from Figure 5.1, discuss how the puffer fish toxin may affect nerve variety of cell types and are able to bind with ligands such as collagen .
activity. [4]
Lowered nerve activity [1]
Due to increased stimulus threshold

Less likely (or an actl.on potential to be generated
Quote data
[max 2]
Or
Due to decreased amplitude of potential (mV)

Weaker action potentials
Quote data
Or .
Due to Increased latencylrefractory period

Less action potentials can form
Quote data
[total max 4]
(c) Based on the data provided, suggest what the symptom of puffer fish poisoning may be.
[1]
Paralysis CopyrioN 0 2009 Pearson Educolion.- tnc.
Figure 5.2
,
\,
(d)(i) Describe how the integrin receptor may respond to the binding of a ligand. [2]
Change in conformation
Activation of a relay molecule I activation of talin
AVP
(ii) lntegrin receptors are not known to have kinases associated with them. Suggest a
possible problem this might present to the cell signaling pathway. [1]
Cannot trigger trans~uction directly I requires the formation of a second messenger.
[Total : 11 marks]
10 II
www.gradtutors.com
(c) Certain organisms are able to survive in the absence of oxygen. Describe the way that
Question 6 two named organisms obtain the energy for survival in the absence of oxygen. [4]
Figure 6.1 illustrates the movement of electrons through certain eukaryotic organelles. Anaerobic respiration (0 .5]
Yeast [0.51
Pyruvate broken down to ethanal then to ethanol
ase enzyme Mammals (0.5]
Pyruvate broken down to lactate [0.5]
NAD' regenerated in both processes [0.5]
Electron Allows for glycolysis to continue [0.5]
Produces 2 ATP per glucose for survival [1]
Max4
,,
',
.
[Total:' .11 .inarks]
~' ~ .
Figure 6.1
(a) Name two eukaryotic organelles that contain an electron transport chain sim il ar to the one
shown in Figure 6.1. (2]
Chloroplasts and Mitochondria
{b) Using a named example, explain how the electron transport chain allows the organelle
containing it to achieve its function. [5]
Named example: Chloroplast (Photosynthesis) I Mitochondria (Respiration)

Function : Produce A TP
Transport of electrons along the chain leads to energy lost by the electrons
Energy captured to pump H' into space (defined based on organelle)
H' diffuses out of space through ATP synthase complex I stalked particles
ATP synthase makes ATP from ADP and P,
Max: 5 marks
12 13
www.gradtutors.com
Q7. Sickle-cell anaemia is a genetic blood disorder characterized by red blood (d) In areas where malaria is common , explain the expected changes in frequency
cells that assume an abnormal, ri gid, sickle shape. Life expectancy is shortened, of the HbS allele in a population's gene pool over successive generations as a
with studies reporting an average life expectancy of 42 in males and 48 in result of natural selection. [3)
females.
Correct identification of selection pressure (combination of parasitism by
malaria and loss of fitness associated with HbS allele).
The gene defect is a known mutation of a single nucleotide, which results in
Correct Identification of the fitter phenotype (heterozygote individuals
glutamC)te being substituted by valine at position 6. The genetic disorder is due to
with the benign sickle trait).
the mutation of a single nucleotide, from a GAG to GTG codon 111utation. In
Resulting In the persistence of the HbS allele In the population's gene
conditions of normal oxygen concentration , the mutation causes no apparent
poo/1/ncrease in frequency of HbS allele.
effects on the secondary, tertiary, or quaternary structure of haemoglobin.
However, under conditions of low oxygen concentration, the deoxygenated form of
haemoglobin exposes a hydrophobic patch on the protein, which the hydrophobic
In an investigation designed to assess the possibility of using RFLPs to screen for
residues of the valine at position 6 of the beta chain in the sipk/e-cell haemoglobin
sickle cell anaemia, it was determined that the HbS allele was frequently
are able to associate with, causing molecules of haemoglobin S molecules to
associated with a 13kb restriction fragment, associated with the loss of a hpal
aggregate and form fibrous precipitates.
restriction site adjacent to the haemoglobin gene locus, caused by the insertion of
several nucleotides within the restriction site.
(a) Explain the meaning of "selection pressure". [1]
The insertion mutation in the hpal restriction site is known to be selectively neutral.
Any effect that gives a fitness advantage to specific phenotypes In a The neutral theory of evolution proposes that changes in the frequency of most
population. selectively neutral alleles in a population's gene pool are caused by the process of
genetic drift.
(b) Compare the relative biological fitness of an individual which is homozygous (e) Explain the meaning of the phrase "selectively neutral". [1)
for the HbS allele and an individual which is homozygous dominant for HbA. (1)
Individual homozygous dominant for HbA has higher biological fitness. Mutation which does not result in any change to the biological fitness of
an organism.
In areas where malaria is common , those with only one of the two alleles of the
sickle-cell haemoglobin are more resistant to malaria, since the infestation of the (f) Briefly describe the process of genetic drift. (2]
malaria parasite is halted by the sickling of the cells which it infests. When within
the erythrocyte, the parasite produces a group of enzymes known as p/asmepsins , Genetic drift is the random change in allele frequencies due to chance
which are aspartic proteases used to degrade haemoglobin. Some of !tie amino factors.
\. acids produced by the hydrolysis are then utilized in the synthesis of parasite These include randomness arising from meiotic processes (e.g. crossing
protein.
over) and from random gamete fusion [1/2], as well as
(c) Suggest why the parasitic infection of the red blood cells is less effective in Differences in number of offspring in each family. [1/2]
Individuals who carry a single copy of the HbS allele . [2)
Structure _of the aggregated HbS precipitates not complementary to the (g) Explain whether the high frequency of individuals with the HbS allele in regions
plasmepsin active site. of where malaria is common is caused by genetic drift. [2]
HbS not broken down by plasmepsins.
Parasite unable to obtain sufficient amino acids for the synthesis of Its No. [1]
proteins. High frequency caused by linkage to the HbS allele. [11
14 15
www.gradtutors.com
(b) Compare and contras t the changes described in the section above with those ,
Section B {20 marks) associated with the different stages of meiosis I. [6]
Question 8
o Any valid similarities In mechanism of chromosomal movement during
(a) With the aid of labeled diagrams, describe the changes within the cell associated metaphase and anaphase by means of splndle.apparatus [max 2)
with the different stages of mitosis. [1 OJ l' '
o No synapsis/crossing over In prophase of mitosis, compared with meiosis I.

Prophase. o Single row of chromosomes aligned at the equator of spindle lri metaphase
Correctly labeled diagram of mitosis, compared with two rows in meiosis I.
Chromosomes condense o Separation of sister chromatids In anaphase of mitosis, compared with
and become visible as a pair of Identical sister chromatids. separation of homologous chromosomes in meiosis I.
o Formation of two diploid nuclei In telophase of mitosis, compared with
Centrioles move to opposite poles.
formation of two haploid nuclei in meiosis I.
From the centrioles, microtubules develop and form a star-shaped
structure called an aster.
The nucleolus and nuclear envelope gradually disappear. (c) Explain the importance of meiosis to sexually reproducing organisms. (4]
The spindle fibre forms.
Me'iosis is needed for the formation of haploid gametes for sexual
Metaphase reproduction. [1)
Correctly labeled diagram Ensures that doubling of chromosome number for each successive sexually
Chromosomes migrate to the equator of the spindle reproduced generation does not occur. [1)
Sister chromatids aligned at right angles to the spindle fibres
in a single row. Meiosis generates genetic variation by :
Chromosomes are attached to the spindle fibres
at the kinetochore of centromeres. Random orientation of the pairs of homologous chromosomes on the
equator during metaphase I (Independent assortment)
Anaphase. Crossing over of segments between non-sister chromatids of homologous
Correctly labeled diagram chromosomes during Prophase I of Meiosis I.
The centromeres of each chromosome divides into two. Random fusion of gametes during fertilization .
Each sister chromatid separates to move to opposite poles of the cell [0.5 marks; max 1)
due to shortening of centromere-to-pole spindle fibres.
Provide variation for evolution by natural selection, allowing species to
Telophase. constantly cl]'ange and adapt to changing environmental conditions. [1]
Correctly labeled diagram
The individual chromosomes arrive at opposite poles of cell.
Spindle fibres disintegrate.
Chromosomes uncoil and
become chromatin threads.
Nuclear envelope reforms around chromosomes at opposite poles.
Nucleoli reappear.
Cleavage furrow starts to form .
[0.5 marks each)
16 17
www.gradtutors.com
AVP
Question 9
(a) Describe the function of telomeres In eukaryotic cells undergoing DNA replication. (c) Name and briefly describe the functions of two other noh-coding sequences
[8] required in the control of gene expression in eukaryotes. [4]
Telomeres are special nucleotide sequences found at the ends of each Promoter+ binding site for RNA polymerase and general/basal transcription
chromosome. factors, allow the proper attachment of the RNA polymerase to the promoter.
Multiple repetitions ofa short nucleotide sequence. Terminator specifies the end of the transcription process , binding site for
During semi-conservative replication, at the 5' end of each replicated strand, protein factors; which cleave the growing RNA chain .
there Is no existing 3' -OH group beyond the primer to allow DNA Enhancer bind.transcription factors called activators, Increases rate of
polymerase I to replace the RNA primer. transcription.
These single-stranded ends produced by the removal of the RNA primer are Silencer bind transcription factors called repressors, decreases rate of
trimmed, causing chromosomes to get shorter with each cell division. transcription .
After repeated rounds of replication and cell division, essential genes would
be deleted from the ends of the chromosomes .
Telomerlc DNA protects the organism's genes from being eroded through
successive rounds of DNA replication
Prevent chromosomal instability caused by the single-stranded ends formed
via the Incomplete semi-conservative replication.
Prevent the ends from activating the cell's systems for monitoring DNA
damage.
AVP
"
(b) Describe the function of telomerase and explain why its expression is necessary in
a named cell type in the human body. [8]
Telomerase Is a ribonucleoprotein (a complex of RNA and proteins)

Functions as a reverse transcrlptase (a protein that synthesizes DNA from
an RNA template).
A single RNA molecule provides a template to guide the Insertion of the
repeated sequences.
A protein component called hTERT In humans ("human telomere reverse
transcrlptase") which provides the catalytic action.
Telomerase catalyzes the extension of the 3' overhanging end.
The cell's standard replication machinery then extends the complementary
DNA st rand.
Telomerase Is normally expressed In stem cells.
As they need to divide regularly.
18 19
www.gradtutors.com
Section A (45m)
CANDIDATE NAME (CG) INDEX NUMBER _ _ _ Answer all questions in the space provided
Question 1
The Fas receptor gene (Fas) is a tumour suppressor gene that enco d es a . . ..
SERANGOON JUNIOR COLLEGE transmembrane receptor protein. On binding lo an extra-cellular ligand , the receptor
JC2 PRELIMINARY EXAMINATION 2010 trimerizes and is internalized into the cytoplasm of the cell , where it initiates a variety of
proteolytic pathways wh ich eventually result in DNA degradation. membrane blebbing,
BIOLOGY Paper 3 (Applications)- 9747 and other hallmarks of apoptosis.
Higher 2
Monday
24 May 2010 (a) Explain the term "tumour suppressor gene'' . [1]
1 hour 30 mins A gene that codes for a protein +
Additional materials: Answer paper prevent inappropriate cell cycle progression [1/2]
inhibiting cell growth or division [1/2],
Write you r name and index number in the spaces at the top of this page and on all the work you Students do not exhibit the idea that tumor suppressor genes have functions in normal
hand in. ~~ . '
Studenls,9o not make reference to genes as functioning by coding for proteins. ,
The organization of the Fas gene is shown in the diagram below:

-PI
lntron 1 ln l ro n 2 lntr o f\ J l nt ron 4 lntr on 'S lntr on G l ntr on 7 l nt ron 8

-P2
Answer all questions. 12kb 4.Si b l kb !.Si b O. li b l.l kb l . ~ib O.Bkb

Write your answers in spaces provided on the question paper. - - - - - - h tran llul ar realo n - - - -- -
-r- +---
Trnu mt mbrarut roalon
lnt uc:ellul-. r re elo n ___.
At the end of examination,

1. fasten all your work securely together; Using mRNA from normal epithelial cells {E1) and cells from two different skin cancers
identified as deficient In Fas function (81 and 82), reverse transcription was carried out.
INFORMATION FOR CANDIDATES primers P1 and P2. which are specific to the exon regions as shown in the diagram
The intended number of marks is given in brackets [ ] at the end of above.
This question paper consists of printed pages.
www.gradtutors.com
937kb =62 kb shorter;

gel image below. RNA splicing mutation with exon 6 absent from splice site.
El Sl 52 Ladder No band.
Either no expression of gene, or Exon 1 or exon 9 absent from mRNA.

c==J c:==J c:==J c:==J
lOOObp
900bp In a subsequent experiment, a Southern blot was performed using the mRNA from
(937bp)
80Qbp sample S2, using a 200-nucleotide hybridization probe corresponding to sequences
700bp
detected.
600bp
(e) Using information from Figures 1.1 and 1.2 above , explain the results of the
SOObp Southern blotting experiment. [2]
Fas gene is expressed, but either splicing error or early termination of transcription.
Exon 9 is absent from mRNA.
(a) Explain why reverse transcription of mRNA was carried out prior to the PCR reaction .
[2] .
(f) In addition to evasion of programmed cell death (apoptosis), name three other
Create eDNA from the mRNA in the cell. features commonly associated with cancerous cells. [3]
Taq polymerase can only act on a DNA template. Metastasis, angiogenesis, chromosomal instability, AVP.
(b)Briefly explain why DNA fragments are separated by size when run in an aQarose
gel. [2] [15 marks)
Negativ~ly charged DNA backbone;

Migrates towards anode.
Matrix of gel impedes movement of fragments.
Larger fragments move slower than smaller fragments .
(c) Deduce the size of the fragment from the normal epithelial cell. [1]
999 kb
3 4
www.gradtutors.com
Question 2
In the process of cloning a eukaryotic gene in a prokaryotic host, plasmids carrying selectable (c) Explain the function of the selectable marker genes found on cloning vectors. [2]
markers are often utilized as cloning vectors. A suitable cloning vector may be made fro m the
two plasmids shown in the diagram below. Allows identification of bacteria carrying recombinant plasm ids
utZif M
Modifies the phenotype of the bacteria.
(d) Name the protein product of the LacZ gene, and describe how it is used as a selectable
marker. [3]
B-galactosidase
pAMP pLac
4529bp 4823bp X-Gal. Converted into a blue compound.
-;.~
Colonies that are blue have plasmids which do not carry an inserted gene, colonies that are
white have an inserted gene.
A student attempts to clone a gene of interest into the recombinant plasmid obtained fro111 step (a)
above. Asthe gene of interest is known to be flanked by EcoR 1 restriction sites, he first
~u;,a ,duJ I!
with restriction enzyme EcoR I for an hour before mixing the reaction mixtures together for
ligation.
Both pAMP and pLac are known to contain BamH I and EcoRI restriction sites and an origin of
replication each. The key difference is that pAMP contains the ampicillin resistance gene while (e) Explain the problem with the student's procedure, and suggest a possible improvement to the .
pLac contains the LacZ gene. procedure. [3]
To form the desired cloning vector, both pAMP and pLac are treated with a mixture of restriction Fragment will not be inserted into the selectable marker.
enzymes, namely BamH I and EcoRI. The restriction fragments obtained are allowed to ligate to Not possible to distinguish between recombinant and rejoined plasm ids after ligation.
form several possibilities of circular plasmid, which can then be separated using electrophoresis Select an alternative restriction enzyme with a restriction site in the lacZ gene.
to obtain the desired product. Use linker DNA to create sticky ends.
(a) In the space below, draw and annotate the desired product formed from the two plasm ids. [2] (f) State one additional feature the recombinant plasmid must possess before it <;an be used as an
[112 each for origin of replication, LacZ, ampr genes and size of recombined plasmid] expression vector f?r the inserted gene. [I]
Bacterial promoter up~tream of inserted gene.
(b) State the source and natural function of restriction enzymes. [I]
(g) What are the possible problems faced when expressing a eukaryotic protein in E. C()lf! [3]
Restriction endonucleases are produced by bacteria as a defense mechanism against
infection by viruses. Inability of prokary6te cells to recognize eukaryotic promoters.
These enzymes functions like "molecular scissors", and restrict the growth of foreign Inability of prokaryotes to excise introns.
DNA in the bacterial host by cutting up DNA molecules into fragments, which are known as Eukaryotic proteins may not fold correctly/inability to carry out correct post-translational
restriction fragments. modification.
[Total: 15 marks)
5 6
www.gradtutors.com
question 3
1.8 .,-----..-----,.-------,
1~ I C
gene (81) from a bacterium, Bacillus thurfngensis. The gene codes for a toxi n, which is .1A ,.-
expressed in the leaves and acts as an insecticide. mean area /
of leal eaten 1.2 _.. B
(a) Explain pet caterpillar/ / ,'
arbitrary units 1.0 ...
(i) what is meant by a transgenic variety of maize. (3]
0.8 .... / ' '
Maize with a foreign gene Inserted. o.s ... _... v' A
Foreign gene in this case Is the Bt gene
04 . ::::___,...,_- -- /
Foreign gene must be expressed
0.2 .. ::"~~-- --- - v
(ii) why farmers in the USA grow maize carrying the Bt gene. [2) 0
day 1
..:.=-----'day 2 day3 day 4
Maize plants will produce Insect toxin I kill insects
Control insect Infestation without chemical Insecticides Figure 3.1
Results In higher yield
. method by which the Bt gene can be introduced into the plant. [1)
Gene gun I Electroporatlon

.A
key
IS! B
oc
The Bt gene is also expressed in pollen, which may be dispersed by wind, at least 601'(1 away
from'the parent plant. In the USA, milkweed frequently grows around the edge of maize.fields
In an experiment 'conducted to investigate the environmental effects of Bt maize, leaves of the \ Figure 3.2 \
milkweed were divided into three groups, A, 8 and C, and treated in the following ways: (b) With reference to Figs. 3.1 and 3.2,
B : dusted with pollen from maize that had not been genetically modified; (i) comment on the effect of consuming pollen from genetically modified maize carrying the
C : not dusted with pollen. Bt gene on the mean area of leaf eaten per caterpillar. [4)
Monarch caterpillars were then placed on the leaves and the mean area of leaf eaten per Mean area of leaf eaten Increased
caterpillar and the survival of the caterpillars was measured over four days. The results of the From almost zero au on day 1 to almost 0.6 au on day 4
investigation are shown in Fig. 3. 1 and 3.2. However, this increase was less than the Increase seen In caterpillars feeding on non-
genetically modified pollen and those feeding on leaves without pollen
Quote suitable data
Po llen from genetically modified maize appears to lessen the eating rate of
caterpillars
Pote ntially due to lowered survival rates I Quote data from figure 3.2
ax4
7 8
www.gradtutors.com
(ii) compare the effect of consuming pollen from different maize plants on the survival of Section B (20 marks)
Consuming non-genetically modified pollen leads to 100% survival by day 4
Consuming genetically modified pollen negatively Impacts survival/ only 50% Your answers should be illustrated by large, clearly labelled diagrams, where appropriate.
survival by day 4
Question 4
In the USA, 50% of the summer population of Monarch butterflies is fo\J nd in the maize-growing
period when Monarch caterpillars are feeding . 4 (a) Explain, with examples , what is meant by gene therapy and discuss its ethical
implications in humans . [10]
cultivation of Bt maize in the USA on the population of Monarch butterflies. [3] o Defined as the introduction of new gene material into the cell of an individual
with the intention of producing a therapeutic benefit for the patient
There will be a drop In population size of Monarch butterflies
As Monarch caterpillars will be feeding at the same time that Bt maize pollen will be Common approach in gene therapy involves:
shed o Insertion of normal gene into a non-specific location within the genome to\
Leading to lowered survival rates of Monarch caterpillars and thus less butterflies
replace~ non-functional gene
produced
[Total: 15 marks] o Alter the regulation of a particular gene
o Current gene therapy strategies being investigated involved single-gene

disorder, such as cystic fibrosis (CF) I SCID
o The ultimate aim of gene therapy in the treatment of cancer cells is to introduce
genes to kill the cells concerned
o For the treatment of cystic fibrosis, it is to introduce gene encoding for CFTR
into the target cells (lung cells)
o There are two types of gene therapy: germ-line c;~nd somatic cells gene therapy.
Germ-line gene therapy is the introduction of corrective genes into reproductive
cells (sperm or egg cells) or zygote and can be passed on to descendents
o Somatic cell gen~ therapy is to correct a disease phenotype by treating some

somatic cells in the affected person and cannot be passed on to descendents
The delivery of therapeutic material to target cells in gene therapy can occur In
two ways: j .
o Insertion of genes into cells from the affected tissue outside the body, and
these cells are then returned back to the body (ex vivo gene therapy)
o Delivery of therapeutic gene directly into the body at the required site (in vivo)
o Use of viral or non-viral vectors

Max 5
9 10
www.gradtutors.com
Arguments for gene therapy Include: . (b) Compare the mutations responsible for cystic fibrosis (CF) , X-linked and ADA-
o Extension to conventional therapies as It represents novel ways to produce defi cient severe combined immunodeficiency (SCID) and comment on their pattern of
same medications that are available at high cost. One example is the treatment of inheritance. [6]
SCID due to ADA deficiency, where the enzyme adenosine deaminase is
expensive and has to be taken frequently Xlinked SCJD ADA-deficiency Cystic fibrosis
SCID (CF)
o Alternative treatment for patients where conventional treatments have failed Inheritance X-linked Autosomal Autosomal
recessive recessive
o Germ-line gene therapy ensure that diseases can be eradicated .\ n subsequent Chromosome affected X chromosome Chromosome 20 of Chromosome 7 of
generations. For example, successful germ-line gene therapy would have the ADA aene CFTR qene
potential to eliminate genet ic defect, such as hemophilia, from an entire family Clinical symptoms Absence of Absence of Accumulation of
line with a single procedure infection fighting infection fighting sticky mucus,
cells i.e. T and 8 cells i.e. T and 8 leading to chronic
o Scientific community has the right to enquire into new methods of treating cells. Patients will cells. Patients will infection
disease, within the bounds of acceptable human research be prone to virus be prone to virus
and bacterial and bacterial
o From a public health perspective, efficient prevention of disease and infection infection
conservation of future health care resources may indicate that gene therapy is in
favor. 0.5 marks per point, max 3
Arguments against the use of gene therapy: Pattern of inheritance for X-linked SCID:
o "Slippery slope" argument whether it is possible to distinguish between "good" o Thus, a female who is a carrier for Xllnked SCID may shows no signs of
and "bad" uses of the gene modification techniques and whether the potential for immunodeficiency
harmful abuse of the technology should keep us from developing more
techniques o Her sons and daughters have a 50 percent chance inheriting the X chromosome
with the mutation
o Altering of human gene is against the will of god and people still sees it as
tempering with nature o The son who has inherited one copy of the mutant X chromosome will have X-
', linked SCID
o Difficulty in following-up with patients in long-term clinical research as patients
have to be under surveillance for long term effects of the therapy on future o The daughter who has inherited one copy of the mutant X chromosome will be
generation carriers like their mother
o Issues on the safety and efficacy of gene therapy as compared to conventional 0.5 marks per point, max 1
therapies as a few unexpected complications and side effects have been
identified Pattern of inheritance for ADA-defic ient SCID :
o Sufferers must be homozygotes since it is a recessive disorder
o Justice and resource allocation such as to avoid crediting the high social
priority, for example, who can afford such expensive treatment? Who should o Meaning both parents (if carriers) must pass on the defective gene for any of
receive the treatment? What can be done to assure voluntary consent of the their children to get the disease
patients?
o Het erozygotes are carriers as they carry only one copy of the faulty gene
o Too much scientific uncertainty and clinical risk as th is t herapy Is still in t he
clinical trial stage o The chances of 2 carriers having a ch ild w ith cystic fibrosis are 1 in 4
max 5 0.5 mark s per point, max 1
11 12
www.gradtutors.com
Pattern of inheritance for cystic fibrosis:
o Sufferers must be homozygotes since it Is a recessi ve disorder
o Meaning both parents (if carriers) must pass on the defective gene for any of
their children to get the disease
o Heterozygotes are carriers as they carry only one copy of the faulty gene
o The chances of 2 carriers having a child with cystic fibrosis are 1 in 4
o Males sterile
0.5 marks per point, max 1
(c) Explain how embryonic stem cells cou ld potentially be manipulated for therapeutic
applications. (4]
o Embryonic stem cells can be derived from the inner cell mass of the early '\
embryo (blastocyst) '
o The inner cell mass is then isolated
o This is followed by the isolation of a single cell to create an embryonic cell line
due to their ability to self-renew
o Genetic manipulation can be carried out by the random incorporation of DNA

within the genome by methods such as electroporation
o One can culture the embryonic stem cells under specific conditions using
appropriate growth factors and chemicals
o Can be induced to differentiate into different cell types
o These desired cell types can then be transplanted I re-introduced back into the
patient
o One example will be the use of embryonic stem cells in the production of
insulin-producing pancreatic cells for people with diabetes OR differentiation of
embryonic stem cells into nerve cells for the treatment of patients with
Parkinson's disease I Huntington's disease
Max4
13
www.gradtutors.com

2010 A Level h2 Biology Serangoon JC

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

2010 A Level h2 Biology Serangoon JC

Uploaded by

Copyright:

Available Formats

2

This question paper consists of 21 printed pages and 1 blank page.

Solution Colorimeter cells broken open

5. The enzyme amylase hydrolyses starch into disaccharides. Amylase is unable to

next l8ryest and densest

C the bonds between sugars in cellulose are much stronger.

A 182 nucleotides I. The anti-parallel arrangement of the DNA strands.

A Addition of an extra nucleotide

summarized by the student in the table below:

Resulting growth of hybrid cells Type of gene mutated In the

(4) Grows uncontrollably Mutated tumour suppressor gene

A (1) and (3)

A The possession of one nucleolus is due to autosomal linkage.

' (Pl (Q)

A 2 females (both normal): 2 males (both abnormal)

IV Poorly adapted spiders have decreased survivorship. Human (H u}

. From the information given, which conclusion is correct?

A Birth weight is undergoing stabilizing selection

medium wllh arnplclllln medium wUh the antibiotic

High sensitivity to contamination from non-template DNA

!!:!"d..:j . lliMJ I ~ I &!!!iJ I '"'"' J I ,IJ!!ILI I ~i'!!t!.;!

1 Survive on ampicillin-containing medium

Questions 39 and 40 refer to the following information.

a gene encoding a toxin from the bacteria Bacillus thuringiensis wh ich is

39. What is the function of the 'pat'-gene on the cloning vector? \

CANDIDATE NAME (CG) - - - - - - - - - - INDEX NUMBER _ _ __

SERANGOON JUNIOR COLLEGE

BIOLOGY Paper 2 (Core)- 9648/9747

READ THESE INSTRUCTIONS FIRST

Write in dark blue or black pen.

Do not use staples, paper clips, highlighters, glue or correction fluid.

Answer all questions in Section A and only one question in

This question paper consists of 19 printed pages and 1 blank page.

Answer all questions in the space provided

The figure below shows an electron micrograph of a eukaryotic cell.

(a) Label the structures A, B, D, and E. [2]

(b) List two main functions of structure F. [2]

0 0. 0 0 0 0 0 .... . 0 0 0 _ , _ : ....... . ... .. .

.... ..... ..... .. ......-............................................... ... ...... ............. . ........................ .

[EI~~1o"&rg~fii~If&Q'iiJgo't1n(lriJ:\~l~ni)~:fi1. are known to affect the rate of DNA a-mplification by

Based on the results above, answer the following questions:

.. ~ .. . . . . - . . . . . . . . . . . . . . . . :. ..... . ... ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . ~ !' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

(a) Illustrate this cross in the space below. [5] .

(a) How does genetic recombination typically occur in eukaryotes? [2]

(c) Explain the meaning of the phrase "temperate phage". [1]

Copyright ll:l2009 Pearson Education, Inc.

(a) Explain the meaning of "selection pressure". [1]

.......... .............. ... .......... .........................................................................................

(e) Explain the meaning of the phrase "selectively neutral". [1]

(f) Briefly describe the process of genetic drift. [2]

Section B (20 marks)

Answer one question.

Write your answers on the separate answer paper provided.

(c) Explain the importance of mei9sis to sexually reproducing organisms. [4]

CANDIDATE NAME (CG) - - - - - - - - - INDEX NUMBER _ _ __

SERANGOON JUNIOR COLLEGE

BIOLOGY Paper 3 (Applications)- 9648 -

READ THESE INSTRUCTIONS FIRST

Write in dark blue or black pen.

Do not use staples, paper clips, highlighters, glue or correction fluid .

Answer all questions.

This question paper consists of 14 printed pages.

(a) Explain the term "tumour suppressor gene". [1]