You are on page 1of 7

Hasil primaclade.

org

Generated primers for kel1fas.fas:


-------------------------------------------------

---------1---------2---------3---------4---------
5---------6---------7---------8---------9---------0---------1---------
2---------3---------4---------5---------6---------7---------8---------
9---------0---------1---------2---------3---------4---------5---------
6---------7---------8---------9---------0---------1---------2---------
3---------4---------5---------6---------7---------8---------9---------
0---------1---------2---------3---------4---------5---------6---------
7---------8---------9---------0---------1---------2---------3---------
4---------5---------6---------7---------8---------9---------0---------
1---------2---------3---------4---------5---------6---------7---------
8---------9---------0---------1---------2---------3---------4---------
5---------6---------7---------8---------9---------0---------1---------
2---------3---------4---------5---------6---------7---------8---------
9---------0-----
EF582837.1:120-884
ATGGAATCCCAGATGACATGCAACGTTAGCGAGATGTGGAGCTCCAGGATGCCTGAGGGACTGGAACTTGAGATTTCC
CATCATCCACTGACAATGAAGCACGTGGCCAACCTCATCATCGCCACACAGAGGTTTAAGGGCATTATCTCAGAATCA
GTGCTGGGCACTGAATTCAGAGATGAACATCTGCTCAGCATCATGCTGGAGAGCATCGTGGAAGAGAGAAATGTGTTC
GGTTGTGAGGCAACTCCACCGACTGATGAGGATATGATCACCAGGACGCGCGAGTACGACTGCACTGTGGAGGACGAG
GAGAAGAGGAGCTTAGTTCGGGTCAATAACAGCCTGGTGCTCCACGCAGTGATGCTGCAGGGAGGAACTGATCTCAAG
CAAGTTAAACTGAACATGTCAATGTACTTGCACCCTGCACCCAGCGTTGAGGGCAGAACTGTGGCTCTGGGCATCAAG
GGCA-----CACAGTAT-
TACCTGACTTGCCGTAAGGACGGTACCCAGCCAACCTTACATCTGGAGACGATTACCAAAGACAGCCTGGCATC----
-----------
AATCGACCCGAACAGCGACATGGTGCGGTTTCTCTTCTACAAGCAGATCTCTGGGGTGAATGTCAGCACCCTCATGTC
TGTCGCTCACCCCAACTGGTACATCAGCACAGCAGAGGCTGACAACATGCCAGTGGAGATGTGCCAGGAGTCCACCAG
CCGCTACAGAGCCTTCACCTTCAGTGCAATCAAGGAGGAGACACCCACAGCTTGA-----
AJ557885.1:89-841
ATGGGATTCGAGATGAAATGCAACATGAGCCAGATGTGGAGCTCCGATGTGCAGTCGGGGCTGGACTTTGAGATTACC
CATCATCCCCTGACAACGAGGAAAGTGGTCCACCTCATCATCGCCATGGAGAGGATGAAGGGC------
TCAGAATCAACGCTGAGCACTGAATTCAGAGATGAAAACCTCCTCAACTTCATCATGGATAGCATAGTGGAAGAGCAA
ATTGTGTTCGAGTGTGCCTCTGCTCCACCAGCTCA---------
GATCACACGGACGGACGTAGAACCGCAAAACATAACCGACGGCGAGAAGAGGAGCTTAGTTATGGTCCAAAACAACAT
GGAGCTCCATGCAGTGACGCTGCAGGGAGGCGCTGATTCCAGAAAAGTTTTCCTGAAGATGTCGACCTTTTTGCACCC
TGCGTCCACCATTGGGGGCAGAACTGTGGCTCTGGGCATCAGGGGC------
CAAAATCTGTACCTGTCATGCCGCAAGGATGGTGACAGTCCAACCTTGCATCTGGAGACATTGGAGGACAATAGTCTG
TTGAA---------------
CATCAGCTCAGACAGCGACATGGTGCGATTTCTCTTCTACAAACAGGACACCGGGGTGAACATCAGCACCCTCATGTC
TGTCGCTCAACCCAACTGGTACATCAGCACAGCAGAGCAAAACAACAAGCCGGTGGAAATGTGCCTGGAGACCGCCAA
ACGCTTCCGCTCCTTCAACATTGGTGACATCCA--AGGAAATGTTGATCGCCAGAGTTAA
(KP069026.1:26-245,
ATGGAATCCGAGATGACATGCAACGTGAGCGAGATGTGGAGCCCCAAGATGCCCGAGGGACTGGACTTTGAGATTTCC
CATCATCCACTGACAATGAAGCGCGTGGTCAACCTCATCTTCGCCATGGAGAGGTTTAAGGGCGGCCGCTCAGAAACC
GTGCAGGGCACTGGATTCAGAGATGAAGACCTGCTCAACATCATGCTGGAGAACCTGGTGGAAGAGGAAATTGTGTTC
GGGTGTGAATCAGCTCCACCAGCTCA---------
GATCACCTGGACGGGCGAGGAACAGTGCAGCATCACCGACGGCGAGAAGAGGAGCTTAGTTCAGGTCCAAAACAGCAT
GGAGCTCCACGCAGTGATGCTGCAGGGAGGCGGTGGCACCACAAAAGTTCACCTGAACATGTCGACCTACTTGCACCC
TACACCCAGAGTTCTGGGCAGAACTGTGGCTCTGGGCATCCGAGGCACAAATCCAAATCTCTACCTGTGTTGCCGCAA
GAATGGTGCCAATCCAACCTTGCATCTGGAGGCGGTGGAGAACAAAAGTCTGTTGAGTGGAGCGGGTGTGAGCATCAG
CCCGGACAGCGACATGGTGCGATTTCTCTTCTACAGACAGGACACCGGGGTGAACATCACCACCCTCATGTCTGTCGC
CCACCCTGACTGGTTCATCTGCACAGCAGAGCAGGACAACAAGCCGTTGGAAATGTGCATGGAGTCCGCCAACCTCTA
CCGGACCTTCAACAT---------CCG--AGAGGAGGCTTAA------------
(AJ566198.2:393-606,
ATGGGATTCGAGATGAAATGCAACATGAGCCAGATGTGGAGCTCCGATGTGCAGTCGGGGCTGGACTTTGAGATTACC
CATCATCCCCTGACAACGAGGAAAGTGGTCCACCTCATCATCGCCATGGAGAGGATGAAGGGC------
TCAGAATCAACGCTGAGCACTGAATTCAGAGATGAAAACCTCCTCAACTTCATCATGGATAGCATAGTGGAAGAGCAA
ATTGTGTTCGAGTGTGCCTCTGCTCCACCAGCTCA---------
GATCACACGGACGGACGTAGAACCGCAAAACATAACCGACGGCGAGAAGAGGAGCTTAGTTATGGTCCAAAACAACAT
GGAGCTCCATGCAGTGACGCTGCAGGGAGGCGCTGATTCCAGAAAAGTTTTCCTGAAGATGTCGACCTTTTTGCACCC
TGCGTCCACCATTGGGGGCAGAACTGTGGCTCTGGGCATCAGGGGC------
CAAAATCTGTACCTGTCATGCCGCAAGGATGGTGACAGTCCAACCTTGCATCTGGAGACATTGGAGGACAATAGTCTG
TTGAA---------------
CATCAGCTCAGACAGCGACATGGTGCGATTTCTCTTCTACAAACAGGACACCGGGGTGAACATCAGCACCCTCATGTC
TGTCGCTCAACCCAACTGGTACATCAGCACAGCAGAGCAAAACAACAAGCCGGTGGAAATGTGCCTGGAGACCGCCAA
ACGCTTCCGCTCCTTCAACATTGGTGACATCCA--AGGAAATGTTGATCGCCAGAGTTAA
(EF582836.1:572-791,
ATGGAATCCCAGATGACATGCAACGTTAGCGAGATGTGGAGCTCCAGGATGCCTGAGGGACTGGAACTTGAGATTTCC
CATCATCCACTGACAATGAAGCACGTGGCCAACCTCATCATCGCCACACAGAGGTTTAAGGGCATTATCTCAGAATCA
GTGCTGGGCACTGAATTCAGAGATGAACATCTGCTCAGCATCATGCTGGAGAGCATCGTGGAAGAGAGAAATGTGTTC
GGTTGTGAGGCAACTCCACCGACTGATGAGGATATGATCACCAGGACGCGCGAGTACGACTGCACTGTGGAGGACGAG
GAGAAGAGGAGCTTAGTTCGGGTCAATAACAGCCTGGTGCTCCACGCAGTGATGCTGCAGGGAGGAACTGATCTCAAG
CAAGTTAAACTGAACATGTCAATGTACTTGCACCCTGCACCCAGCGTTGAGGGCAGAACTGTGGCTCTGGGCATCAAG
GGCA-----CACAGTAT-
TACCTGACTTGCCGTAAGGACGGTACCCAGCCAACCTTACATCTGGAGACGATTACCAAAGACAGCCTGGCATC----
-----------
AATCGACCCGAACAGCGACATGGTGCGGTTTCTCTTCTACAAGCAGATCTCTGGGGTGAATGTCAGCACCCTCATGTC
TGTCGCTCACCCCAACTGGTACATCAGCACAGCAGAGGCTGACAACATGCCAGTGGAGATGTGCCAGGAGTCCACCAG
CCGCTACAGAGCCTTCACCTTCAGTGCAATCAAGGAGGAGACACCCACAGCTTGA-----

Consensus
---------

ATGGRATYCSAGATGAMATGCAACRTKAGCSAGATGTGGAGCYCCRRKRTGCMBKMGGGRCTGGAMYTTGAGATTWCC
CATCATCCMCTGACAAYGARGMRMGTGGYCMACCTCATCWTCGCCAYRSAGAGGWTKAAGGGCrkymkcTCAGAAWCM
RYGCWGRGCACTGRATTCAGAGATGAAVAYCTSCTCARCWTCATSMTGGAKARCMTVGTGGAAGAGVRAAWTGTGTTC
GRKTGTGMVKCWRCTCCACCRRCTSAtgaggatatGATCACMHGGACGSRCGWRKAMSMSYRMAVYRTVRMSGACGRS
GAGAAGAGGAGCTTAGTTMDGGTCMAWAACARCMTGGWGCTCCAYGCAGTGAYGCTGCAGGGAGGMRSTGRYHYCAVR
MAAGTTHWMCTGAASATGTCRAYSTWYTTGCACCCTRCRYCCASMRTTSDGGGCAGAACTGTGGCTCTGGGCATCMRR
GGCacaaatCMMARTMTsTACCTGWSWTGCCGYAAGRAYGGTRMCMRKCCAACCTTRCATCTGGAGRCRDTKRMSRAM
RAHAGYCTGKYRWVtggagcgggtgtgagMATCRRCYCRRACAGCGACATGGTGCGRTTTCTCTTCTACARRCAGRWC
WCYGGGGTGAAYRTCASCACCCTCATGTCTGTCGCYCAMCCYRACTGGTWCATCWGCACAGCAGAGSMDRACAACAWG
CCRKTGGARATGTGCMWGGAGWCCRCCARMCKCTWCMGVDCCTTCAMCWTyrgtgmmatCMRggAGRRRABRYYBAHm
gcywgagttaa

Primers
-------
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++TTGAGATTWCCCATCATCCMC start pos=68 approx Tm=59.74 approx
%gc=42.86 length=21 rev comp=GKGGATGATGGGWAATCTCAA
+++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++AGATTWCCCATCATCCMCTGAC start pos=71 approx Tm=60.20 approx
%gc=45.45 length=22 rev comp=GTCAGKGGATGATGGGWAATCT
+++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++ATTWCCCATCATCCMCTGACA start pos=73 approx Tm=60.19
approx %gc=42.86 length=21 rev comp=TGTCAGKGGATGATGGGWAAT
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++TTWCCCATCATCCMCTGACA start pos=74 approx Tm=59.89
approx %gc=45.00 length=20 rev comp=TGTCAGKGGATGATGGGWAA
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++RGCACTGRATTCAGAGATGAA start pos=163 approx
Tm=60.21 approx %gc=47.62 length=21 rev comp=TTCATCTCTGAATYCAGTGCY
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++GACGRSGAGAAGAGGAGCTTAGT start pos=307 approx Tm=59.69
approx %gc=52.17 length=23 rev comp=ACTAAGCTCCTCTTCTCSYCGTC
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++GACGRSGAGAAGAGGAGCTTAGTT start pos=307 approx Tm=60.87
approx %gc=50.00 length=24 rev comp=AACTAAGCTCCTCTTCTCSYCGTC
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+CTCCAYGCAGTGAYGCTG start pos=352 approx Tm=60.14 approx %gc=61.11
length=18 rev comp=CAGCRTCACTGCRTGGAG
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+DGGGCAGAACTGTGGCTCT start pos=440 approx Tm=60.00 approx %gc=57.89
length=19 rev comp=AGAGCCACAGTTCTGCCCH

------------------------------------------------------------------------------
------------------------------------------------------------------------------
------------------------------------------------------------------------------
------------------------------------------------------------------------------
------------------------------------------------------------------------------
---------------------------------------------------------ACTGTGGCTCTGGGCATC
start pos=448 approx Tm=59.78 approx %gc=61.11 length=18 rev
comp=GATGCCCAGAGCCACAGT
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+CCAACCTTRCATCTGGAGR start pos=517 approx Tm=59.77 approx %gc=52.63
length=19 rev comp=YCTCCAGATGYAAGGTTGG
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+CRRACAGCGACATGGTGC start pos=584 approx Tm=59.98 approx %gc=61.11
length=18 rev comp=GCACCATGTCGCTGTYYG
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+CGACATGGTGCGRTTTCTC start pos=591 approx Tm=60.22 approx %gc=52.63
length=19 rev comp=GAGAAAYCGCACCATGTCG
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+GACATGGTGCGRTTTCTCTT start pos=592 approx Tm=60.12 approx %gc=50.00
length=20 rev comp=AAGAGAAAYCGCACCATGTC
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+ACATGGTGCGRTTTCTCTTCTAC start pos=593 approx Tm=59.67 approx %gc=43.48
length=23 rev comp=GTAGAAGAGAAAYCGCACCATGT
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+TGGTGCGRTTTCTCTTCTACAR start pos=596 approx Tm=59.88 approx %gc=40.91
length=22 rev comp=YTGTAGAAGAGAAAYCGCACCA
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+++++++++++++++++++++++++++++++++++++RTCASCACCCTCATGTCTGTC start pos=637
approx Tm=59.83 approx %gc=52.38 length=21 rev comp=GACAGACATGAGGGTGSTGAY
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++ASCACCCTCATGTCTGTCG start pos=640
approx Tm=59.84 approx %gc=57.89 length=19 rev comp=CGACAGACATGAGGGTGST
+++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
+CTGGTWCATCWGCACAGCAGA start pos=669 approx Tm=60.06 approx %gc=52.38
length=21 rev comp=TCTGCTGTGCWGATGWACCAG
---End of Primer List---

Quick Output Key:

Lines with ---- have 0 degenerate bases


Lines with ++++ have 1 to 2 degenerate bases
Lines with **** have 3 or more degenerate bases

Degenerate Primer

Primer pair 1
Self Self 3'
Sequence (5'->3') Length Tm GC%
complementarity complementarity
Forward
TTGAGATTTCCCATCATCCCC 21 57.40 47.62 4.00 0.00
primer
Reverse TCTGCTGTGCTGATGTACCAG 21 60.07 52.38 4.00 4.00
primer
Products on target templates

>XM_010782319.1 PREDICTED: Notothenia coriiceps interleukin 1, beta (il1b), mRNA


product length = 586
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 120 ........A............ 140

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 705 ..................... 685

>XM_008288666.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),


transcript variant X2, mRNA
product length = 598
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 154 .G........A........T. 174

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 751 .GC.................. 731

>XM_008288665.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),


transcript variant X1, mRNA
product length = 598
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 294 .G........A........T. 314

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 891 .GC.................. 871

>XM_007575693.2 PREDICTED: Poecilia formosa interleukin-1 beta-like (LOC103154418), mRNA


product length = 598
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 618 .G..............G.... 638

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 1215 GTG..G............... 1195

>XM_015023254.1 PREDICTED: Poecilia latipinna interleukin-1 beta-like (LOC106940496), mRNA


product length = 598
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 602 .G..............G.... 622

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 1199 GTG..G............... 1179

>XM_014973512.1 PREDICTED: Poecilia mexicana interleukin-1 beta-like (LOC106907688), mRNA


product length = 598
Forward primer 1 TTGAGATTTCCCATCATCCCC 21
Template 596 .G..............G.... 616

Reverse primer 1 TCTGCTGTGCTGATGTACCAG 21


Template 1193 GTG..G............... 1173
Nested Test

Primer pair 1
Self Self 3'
Sequence (5'->3') Length Tm GC%
complementarity complementarity
Forward
GACGACGAGAAGAGGAGCTTAGTT 24 61.92 50.00 4.00 3.00
primer
Reverse
GAGAAACCGCACCATGTCG 19 59.21 57.89 4.00 2.00
primer
Products on target templates

>XM_010782319.1 PREDICTED: Notothenia coriiceps interleukin 1, beta (il1b), mRNA


product length = 282
Forward primer 1 GACGACGAGAAGAGGAGCTTAGTT 24
Template 344 .....A.................. 367

Reverse primer 1 GAGAAACCGCACCATGTCG 19


Template 625 ......T............ 607

>XM_008288666.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),


transcript variant X2, mRNA
product length = 288
Forward primer 1 GACGACGAGAAGAGGAGCTTAGTT 24
Template 384 ...TC.C................. 407

Reverse primer 1 GAGAAACCGCACCATGTCG 19


Template 671 ......T........C... 653

>XM_008288665.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),


transcript variant X1, mRNA
product length = 288
Forward primer 1 GACGACGAGAAGAGGAGCTTAGTT 24
Template 524 ...TC.C................. 547

Reverse primer 1 GAGAAACCGCACCATGTCG 19


Template 811 ......T........C... 793

Kesimpulan

1. Pembuatan primer menggunakan program bioedit harus mengambil basa


nitrogen dari family yang sama agar mendapatkan hasil yang baik dan design
primer yang lebih beragam
2. Dalam menentukan primer yang akan di BLAST harus mendapatkan data GC
dan Tm yang mirip dan untuk Tm diatas 60.00 agar mendapatkan hasil
primer yang baik.