NUCLEOTIDES
A=T
G=C
Each Nucleotide of DNA includes a
nitrogen-containing base.
Base Adenine and Guanine are called
Purines
Base Cytosine and Thymine are called
Pyrimidines
However
Ribonucleic acid containeds
Uracil instead of Thymine
*DNA Contains Bases ACGT while RNA Containes
Bases ACGU
Atom N9 of Purine and atom
N1 of Pyrimidine is linked to a
five-carbon sugar to form a
Nucleoside
A nucleoside + a phosphate group linked to 5 =
Nucleotide
Vitamin= compound that must be obtained from a
diet
DNA is a double helix
Linkage between two bonds =
Phosphodiester bond
End of Polymer bearing a phosphate
group at C5 is 5end
End of Polymer bearing a free OH group
at C3 is the 3end
Base sequence of a polynucleotide is
read from the 5 end (left) to the 3 end
(right). 5->3 Left to Right
DNA contains two polynucleotide strands
whose bases pair through hydrogen
bonding.
Two hydrogen bonds link adenine and
thymine, 3 hydrogen bonds link guanine
and cytosine.
Watson and Crick Model
Two Polynucleotide strands are
AntiParallel
One strand 53 while other strand
35
Dna
DNA segment is expressed in units of
base pairs (BP)
Short single stranded polymer of
nucleotides are called Oligonucleotides
Nucleotides are polymerized by the
action of enzymes known as
POLYMERASES
Phosphodiester bonds linking nucleotide
residues can be broken by the action of
Nucleases.
Exonuclease- removes a residue from
the end of a polynucleotide chain
Endonuclease- cleaves at some other
point the chain.
Polymerases and Nucleases are
usually specific for either DNA or RNA. In
the absence of these enzymes, the
structures of nucleic acids are remarkably
stable.
RNA
Rna is SINGLE STRANDED
Rna strand can fold back on itself so that base pairs
form between complementary segments of the same
strand.
RNA molecules tend to assume 3-d shapes
Resides of RNA are also capable of base-pairing with
a complementary single strand of DNA to produce an
RNA-DNA hybrid double helix.
DNA can be DENATURED and RENATURED
Pairing of polynucleotide strands in a double-
stranded nucleic acid is possible because each strand
forms hydrogen bonds with complementary bases in
the other strand.
Stability depends mostly on STACKING
Interactions, which are a form of Van der Waals
interaction, between adjacent pairs. Stacking
interactions are weak but additive along the length of
a DNA molecule.
Stacking interactions between neighboring G:C pairs
are stronger than those of A:T.
High Heat= Denaturation
When temperature is slowly lowed then it will
renature its self, by restacking the base pairs and
hydrogen bond between complimentary strand.
The ability of short single-stranded nucleic acids
(Either DNA or RNA) to hybridize with longer poly
nucleotide chains is the bases for a number for a
Genes encode Proteins
The complimentarity of the two strands of DNA is
essential for its function as the storehouse of genetic
information, since this information must be
REPLICATED, for each generation.
A portion of the DNA is transcribed to produce a
complementary strand of RNA, then the RNA is
Translated into protein
An organisms complete set of genetic information is
called its genome.
Template strand- Non-coding strand 3 5
The strand that is paired by the RNA Coding
strand5 3
Transcribed RNA is known as Messenger RNA
(mRNA), since it carries the same genetic message
as the gene.
mRNA is translated in the Ribosome, a cellular
particle consisting of protein and ribosomal RNA
(rRNA).
At the ribosome, small molecules called
transferRNA (tRNA) which carry amino acids,
recognize sequential sets of three bases (known as
CODONS).. in the mRNA, through complementary
base pairing.
The ribosome covalently links the amino acids carried
by successivee tRNAs to form a protein.
The proteins amino acid sequence therefore
ultimately depends on the nucleotide sequence of
the DNA
The correspondence between amino acids and mRna
codons is known as the Genetic code.
Total of 64 Codons: 3 of these are stop signals
that terminate translation. The other 61 represent
the standard amino acids found in proteins.
In CF patients, the gene is missing three nucleotides.
This results in the deletion of a single phenylalanine
residue.
GENE number is roughly correlated with organismal
complexity.
Simple orgaisms= Simple genes
Humans and many other organisms are
Diploid (having two sets of genetic
information, one from each parent.
One set of genetic instructions/information =
Haploid)
Higher noncoding DNA as complexity of the
organism increases.
Over 98% of the human genome is noncoding
DNA
But 80% of the human genome may actually be
transcribed to RNA.
Short segments of DNA that are copied many
times and inserted randomly into the
chromosomes are Transposable Elements.
Highly repetitive sequences account for
another 3% of the human genome. (DNA
Fingerprint)
About 45% of the human DNA consists of
moderately repetitive sequences.
1.5% of genome is for coding proteins.
How are genes identified?
Open reading fram (ORF), a computer
can scan a DNA sequence for a stretch of
nucleotides that can potentially be
transcribed or translated.
 Genes that appear to lack counterparts in
other species are known as Orphan
genes.
Genome maps, indicate the placement
and orientation of genes on a
chromosome.
When a gene is transferred between
species rather than from parent to
offspring of the same species. Ex. Viruses
which can pick up extra DNA as they
insert and excise themselves from the
hosts chromoromes. Horizontal
Transfer
Transcriptomics and Proteomics
Identifying and quantifying all the mRNA
transcripts from a single cell type yields a
profile of active genes. A population of
mRNA molecules that represent the
genes that are turned on, or transcribed
at one time. Trancriptomics
The collection of DNA sequences is called
a Microarray or DNA chip
Examination of a cells complete set of
proteins that are synthesized by the cell
at a particular point in its life cycle.
Proteomics.
Genetic variations have been linked to diseases
Single-nucleotide polymorphisms (SNPs), these
are the instances where the DNA sequence differs
among individuals to use as genetic markers for
various diseases. On average, the DNA of any two
humans differs in about one base per thousand.
DNA sequencing uses DNA polymerase to make a
complementary strand
The most widely used technique for determining the
sequence of nucleotides in a segment of DNA is the
Sanger sequencing technique or the Dideoxy
DNA sequencing because it usese dideoxy
nucleotides that is nucleotides lacking both 2 and 3
hydroxyl groups.
A procedure in which the molecules move through a
gel-like matrix under the influence of an electric field.
Electrophoresis
Dna polymerase cannot begin a new nucleotide
strand but can only extend a preexisting chain, a
short single-stranded primer that base pairs with the
template strand is added to the mixture.
Polymerase chain reaction amplifies DNA
Restriction enzymes cut DNA at specific sequences
Bactera produce DNA-cleaving enzymes known as
Restriction endonucleases or restriction
enzymes that catalyze the breakage of
phosphodiester bonds at or near specific nucleotide
sequences. These enzymes can destroy foreign DNA
that enters the cell by restricting the growth of the
foreign harmful DNA.
Dna fragments are joined to produce recombinant DNA
DNA ligase (an enzyme that forms new
phosphodiester bonds between adjacent nucleotide
residues) Connects the nick
QUESTION AND ANSWER
1) Pneomococcus Wild= Causes pneumonia and death to mice.
Has enzyme needed to synthesize polysaccharide capsule
causing virulence.
Pneomococcus Mutant = Does not have enzymes needed to
synthesize polysaccharide. Does not cause death
Pneomococcus Heat treated= Heat Destroys the polysaccharide
capsule. Does not cause Death.
Answer ) Mix of Pneomococcus Mutant and Heat = Heat destroys
polysaccharide capsule but DNA lives, when DNA mixes with
Pneomococcus mutant then it supplies the genes encoding the
enzymes needed for the capsule synthetic pathways the enzyme
lacks. Causes death.
5) Difference between Uracil and Thymine
Thymine contains a methyl group attached to C5 of
the pyrimidine ring of uracil. Thymine= Uracil + methyl group.
Methylation protects DNA.
9) Why is it important for DNA to contain equal AG at CT
residues? And what about RNA?
Answer) They must be equal because each base pair in the
double stranded DNA molecule consists of a purine and a
pyrimidine. Whereas in RNA, it is only single stranded.
13) Since G-C is 3 H bonds and A-T is 2 H bonds, then G-C is
harder to Melt?
Answer) False- because the greater stability of GC is due to the
stronger stacking interactions involving G:C base pairs and does
not depend on the number of hydrogen bonds in the base pairs.
15) DNA from organisms that thrive in hot environments contain
more G and C than from those in a temperate environment.
Higher GC= increase stability of DNA at high temperatures.
21) TRUE OR FALSE
a) A gene is the information that determines an inherited
characteristic such as flower color
b) A gene is a segment of DNA the encodes a protein
c) A gene is a segment of DNA that is transcribed in all cells.
A) FALSE an inherited characteristic can be determined by more
than one gene
B) False Some sequences of DNA encode RNA molecules that
are not translated to proteins. Ex. rRNA and tRNA
C) FALSE Some genes are not transcribed during a cells
lifetime. This can occur of the gene is expressed only under
certain environmental conditions or in certain specialized cells
ina multicellular organism
23) ACACCATGGTGCATCTGACT
Write the sequence of the Complementary strand that DNA
polymerase would make
Write the sequence of the mRNA that RNA polymerase would
make from the gene segment
a) TGTGGTACCACGTAGACTGA
b) ACACCAUGGUGCAUCUGACU
25) Is it possible for the same segment of DNA to encode two
proteins?
Answer) The same segment of DNA can encode two different
proteins if each strand is a coding strand.