J Cancer Res Clin Oncol
DOI 10.1007/s00432-017-2351-4
ORIGINAL ARTICLE CLINICAL ONCOLOGY
Elevated interferon-induced protein withtetratricopeptide
repeats 3 (IFIT3) isapoor prognostic marker inpancreatic ductal
adenocarcinoma
YueZhao1,6 AnneloreAltendorfHofmann2 IoannisPozios3 PeterCamaj1,6 ThereseDberitz1 XiaoyanWang4
HannoNiess4 HendrikSeeliger3 FelixPopp1,6 ChristopherBetzler1,6 UtzSettmacher2 KarlWalterJauch4
ChristianeBruns1,6 ThomasKnsel5
Received: 16 December 2016 / Accepted: 24 January 2017
Springer-Verlag Berlin Heidelberg 2017
Abstract
Purpose Interferon-induced protein with tetratricopep-
tide repeats 3 (IFIT3) gene from IFITs family is one gene
among hundreds of IFN-stimulated genes. The potential
role of IFIT3 in cancer is scarcely understood. In addition,
the clinical relevance of IFIT3 is not yet known in pan-
creatic ductal adenocarcinoma (PDAC). We evaluated the
prognostic significance of this gene in PDAC patients.
Methods The expression of IFIT3 was analyzed in pan-
creatic cancer cell lines with different metastatic potential
(FG and L3.6pl) and one established gemcitabine resistant
cell variant-L3.6plGres. Second, we analyzed the protein
expression in tissue microarrays (TMA) from specimens of
254 radically resected patients with pancreatic adenocarci-
noma. The prognostic relevance of IFIT3 was evaluated by
the KaplanMeier and Cox regression analysis.
* Christiane Bruns
christiane.bruns@med.ovgu.de
* Thomas Knsel
Thomas.Knoesel@med.unimuenchen.de
1 mary tumors arising from the pancreas. Currently, it is
Department ofGeneral, Visceral und Vascular Surgery,
Otto-von-Guericke University, Leipziger Strae 44,
Magdeburg39120, Germany
2
Department ofGeneral, Visceral und Vascular Surgery,
Friedrich-Schiller University, Jena, Germany
3
Department ofGeneral, Visceral und Vascular Surgery,
Charite University Medical Center, Berlin, Germany
4
Department ofGeneral, Visceral und Vascular Surgery,
Ludwig-Maximilian-University (LMU), Munich, Germany
5
Institute ofPathology, Ludwig-Maximilian-University
(LMU), Thalkirchnerstr. 36, Munich80337, Germany
6
Present Address: General, Visceral andCancer Surgery,
University Hospital ofCologne, Cologne, Germany
Results L3.6pl cells with an aggressive capacity showed
a significant higher expression of IFIT3 as compared to FG
cells. IFIT3 was accumulated in gemcitabine resistant cells.
Overexpression of IFIT3 increased the resistance of apop-
tosis against gemcitabine treatment. Patients who had high
expression of IFIT3 (32%) and received chemotherapy had
a statistically significant reduced survival in multivariate
analysis.
Conclusions High expression of IFIT3 enhances anti-
apoptotic activity and chemotherapy resistance of PDAC
cells. High expression of IFIT3 was independently corre-
lated to shorter patients survival and may serve as a prog-
nostic marker.
Keywords Pancreatic ductal adenocarcinoma IFIT3
Tissue microarray Chemotherapy resistance
Introduction
Pancreatic ductal adenocarcinoma (PDAC) is the most
common type of pancreatic cancer among different pri-
the fourth to fifth most common cause of cancer-related
death in most western countries, with a poor prognosis of
5-year survival<5% (Jemal etal. 2009). Unfortunately, this
poor survival rate has not improved in the past decades, in
spite of developed diagnostic imaging of the pancreas and
aggressive therapeutic approaches. The poor prognosis is
associated with late diagnosis, high rates of operative mor-
bidity, and low response to chemotherapy. Gemcitabine
(2, 2-difluorodeoxycytidine) is a fluoropyrimidine with
anticancer activity in a variety of solid tumors, particularly
pancreatic adenocarcinoma, non-small cell lung cancers,
as well as refractory low-grade non-Hodgkins lymphoma
13
Vol.:(0123456789)

and myeloid malignancies (Carmichael 1998; Michael and
Moore 1997). Despite the value of gemcitabine in improv-
ing clinical benefit and medial survival, to date, satisfactory
outcomes have not been achieved with gemcitabine alone
or in combination with other cytotoxic drugs (Michl and
Gress 2013). Novel approaches targeting tumor cells and
the tumor microenvironment (such as inflammatory factors)
are demanded.
Inflammation and cancer are both complicated patho-
logic processes under the control of many driving forces.
There is increasing evidence that supports the association
between chronic inflammation and cancer development.
Interferons (IFNs) have been considered as the most potent
cytokines of the innate immune system and being able to
drive antimicrobial responses against intracellular virus
infection (MacMicking 2012; Sadler and Williams 2008).
To date, over 2000 human and mouse IFN-stimulated genes
(ISGs) have been identified (Hertzog etal. 2011), and the
interferon produced by tetratricopeptide repeats genes
(IFITs) has been focused, including IFIT1, IFIT2, IFIT3/4,
and IFIT5 (Fensterl and Sen 2011; Wacher etal. 2007). It
is reported that IFIT3 is widely expressed in kidney cells,
T and B cells, plasmacytoid dendritic cells, myeloid den-
dritic cells, and neurons (Fensterl etal. 2008; Wacher etal.
2007).
Our study of gene array data recently identified an
upregulation of IFIT3 in an aggressive pancreatic cancer
cell line L3.6pl compared with its origin, COLO357FG,
demonstrating a oncogene property of IFIT3 with increased
VEGF and IL-6 secretion, chemo-resistance, and decreased
starvation-induced apoptosis by gain of function study
(Niess etal. 2015a, b). Van den Broeck etal. further ana-
lyzed the gene array data sets for expression profiles of
IFIT3 (Broeck et al. 2012). The trend showed that the
expression of IFIT3 was increased in pancreatic cancer
samples of patients with poor outcome as compared to
patients with a good outcome. However, to further evalu-
ate the clinical relevance of this gene, we will analyze over-
all survival depending on the expression of IFIT3 in two
clinical centers and assess the potential of IFIT3 as a novel
prognostic marker in PDAC.
Materials andmethods
Cell lines
An IFIT3 overexpressing cell line FG-IFIT3 was gener-
ated from COLO357FG cell line as previously described
(Niess et al. 2015). The highly metastatic human pancre-
atic adenocarcinoma cell line L3.6pl was used to develop
a gemcitabine resistant cell line (L3.6plGres). L3.6pl cells
were cultured in medium with increasing concentrations of
13
J Cancer Res Clin Oncol
gemcitabine (Gemzar; Lilly Deutschland GmbH, Gieen,
Germany), starting at 0.57.5ng/ml. Cell lines were main-
tained in Dulbeccos Minimal Essential Medium (D-MEM;
Invitrogen GmbH, Karlsruhe, Germany), supplemented
with 10% fetal bovine serum, 2% MEM vitamine mixture,
2% MEM NEAA, 1% penicillin streptomycin, and 2%
glutamax. Cells were incubated in a humidified incubator
(37C, 5% C
O2).
Quantitative realtime PCR
Total RNA was extracted from cell pellets as directed by
the manufacturers instructions. Real-time qRT-PCR was
performed in 20-ul reactions on 100150-ng total RNA
from each sample using the S uperScript III P
latinum
One-Step qRT-PCR Kit as directed by the manufacturers
instructions on the Eppendorf M astercycler ep realplex
PCR system. Primers of IFIT3 and housekeeping gene
control-GAPDH were purchased from Eurofins. The gene
expression was quantified by 2Ct. The primers of the
genes are shown in the following:
IFIT3 forw: GAAGGAACTGGGCCGCCTGCTAAG,
IFIT3 rev: GCCCTGGCCCATTTCCTCACTACC.
GAPDH forw: ACAGTCAGCCGCATCTTCTT,
GAPDH rev: ACGACCAAATCCGTTGACTC.
Apoptotic assay
COLO357FG, FG-IFIT3, L3.6pl, and L3.6plGres at 7080%
confluence were treated with increasing concentrations of
gemcitabine from 25 to100 ng/ml for 24 h. The propor-
tion of apoptotic cells was assessed using FACS analysis as
described (Niess etal. 2015a, b).
Patients
We performed a retrospective analysis of patients with his-
tologically confirmed pancreatic ductal adenocarcinoma,
who underwent surgery for pancreatic cancer (Whipple
procedure, distal pancreatectomy, or total pancreatectomy)
either at the Department of Visceral, Surgery at the Lud-
wig-Maximilian-University of Munich or the Department
of General, Visceral and Vascular Surgery of Jena Univer-
sity Hospital between 1995 and 2012. Samples of resected
specimens were collected for tissue microarray (TMA)
construction. To avoid bias in survival rates by periop-
erative mortality and morbidity, we only included patients
who survived pancreatic resection for more than 90 days.
All data were collected from the database of the Munich
Cancer Registry and the Jena Cancer Registry as well as
the original patients charts. T and N categories of cases
resected before 2010 were restaged according to the 7th
edition of TNM-staging system (Sobin etal. 2010).
J Cancer Res Clin Oncol

Tissue microarray construction FG L3.6pl

IFIT3
Paraffin-embedded archived tissue material of tumor and
surrounding normal pancreatic tissue was used for TMA
construction. TMAs were prepared as published before GAPDH
(Knosel et al. 2005). In brief, the area of interest to be
sampled was identified and marked on hematoxylin-eosin
stained tissue slides. From the corresponding paraffin Fig.1RT-PCR detection of IFIT3 expression in both FG cell line
and L3.6pl cell line. GAPDH was used as a housekeeping gene con-
block (donor block), tissue core biopsies (each 0.6mm in trol. The brightness level displays the mRNA expression of gene.
diameter) were taken out and then arrayed in a recipient IFIT3 expression is much stronger in L3.6pl than FG
TMA block using a manual arrayer (Beecher Instruments,
Sun Prairie, WI). Each case was represented by three core
biopsies from different parts of the pancreatic carcinoma
and two core biopsies from corresponding normal pancre-
atic tissue to exclude artefacts due to heterogeneous anti-
gen expression and to allow comparisons between normal
exocrine pancreatic tissue and tumor tissue. Immunohis-
tochemistry was performed on the sections of the TMA.

Immunohistochemistry

Primary antibodyanti-IFIT3 rabbit polyclonal antibody

(ThermoFisher scientific, Cat. No. PA5-22230, dilution
1: 200) and MACH 3 rabbit AP-Polymer detection sys-
tem (Biocare, Cat. No. M3R533H) were used for TMA
staining and detection according to instructions. All
slides were counterstained with Gills Hematoxylin for
specific nuclei staining (Vector, Cat. No: H-3401). Sys-
tem controls were included to exclude unspecific stain-
ing. The staining of the cells was evaluated and scored
semi-quantitatively: 0, negative staining; 1, weak staining
intensity; 2, moderate staining intensity and 3, strongly
positive staining intensity. Respective pictures were taken
by Zeiss Axioskop microscopy (Zeiss, Wetzlar, Ger-
many) with 100-fold and 400-fold magnification using
Axiovision software.
Statistical analysis
Follow-up was performed in outpatient clinics or by
contacting the patients general practitioners and data
were updated until September 2015. Survival was cal-
culated from the date of pancreatic resection. Statisti-
cal analyses were performed by SPSS 20.0 (SPSS, Chi-
cago, IL) software. Survival curves were calculated by
the KaplanMeier method. The log-rank test was used to
assess differences in survival. For multivariate analysis,
a COX model was constructed. Hazard ratios are given
with 95%-Interval. p value<0.05 was considered to sta-
tistical significance.
Fig.2Gemcitabine resistant cells express more IFIT3 than paren-
tal cells. The gemcitabine resistant variant was established and con-
firmed according to the description. Real-time PCR data showed a
2.7-fold change of up-regulation of IFIT3 in gemcitabine resistant
variant L3.6plGres as compared to L3.6pl parental cells. GAPDH was
used as a housekeeping gene control
Results
IFIT3 andchemotherapy resistance
We published recently that there was a higher expression of
IFIT3 in the highly metastatic L3.6pl cell line than in the
COLO357FG cell line. We confirmed the over expression
of IFIT3 in L3.6pl in mRNA level (Fig. 1). Furthermore,
we found a 2.7-fold expression of IFIT3 in L3.6pl Gemcit-
abine resistant variant-L3.6plGres (p=0.040, Fig.2).
IFIT3 andapoptosis
We incubated the four cell lines COLO357FG, FG-IFIT3,
L3.6pl, and L3.6plGres with increasing concentrations of
gemcitabine. The percentage of apoptotic cells was inves-
tigated by flow cytometry analysis. Without gemcitabine,
we saw almost identical percentages of apoptotic cells
(16.5, 15.6, 17.4, and 15.4% in the COLO357FG, FG-
IFIT3, L3.6pl, and L3.6plGres cell lines, respectively). In

13

the COLO357FG cell line, the percentage of apoptotic cells
was more than doubled by incubation with gemcitabine,
regardless of the concentration (42.5, 44.3, and 48.4% for
25, 50, and 100 ng/ml, respectively). In the highly meta-
static pancreatic cell line L3.6pl, the percentage of apop-
totic cell was increased dependent on the concentration
of gemcitabine. For 25ng/ml, there were 42.7% apoptotic
cells, this proportion decreased to 37.3 and 22.8% for 50
and 100ng/ml, respectively. In contrast to that, we did not
see a remarkable increase of apoptotic cells in the IFIT3
expressing cell line FG-IFIT3; here, the percentages for
apoptotic cells were 20.1, 20.6, and 18.4%, respectively.
The proportion of apoptotic cells was not altered by any
concentration of gemcitabine in the gemcitabine resist-
ant cells too; it was 15.2, 16.8 and 12.4% for 25, 50, and
100ng/ml, respectively (Fig.3).
Clinical description ofPDAC patients
A total of 254 patients were included for TMA construc-
tion. Median age of patients at the time of pancreatic resec-
tion was 66 (3287) years. 187 tumors (74%) could be
resected with clear margins (R0). The majority (166 speci-
mens, 65%) showed high tumor grade. Only 9 patients (4%)
had a pT1 tumor, pT categories 2, 3, und 4 were diagnosed
in 37 (15%), 197 (77%), and 11 cases (4%), respectively.
All operations included a radical lymph node dissection;
the median of lymph nodes dissected was 15. In 77 cases
(30%), no metastatic lymph nodes could be detected. The
other specimens showed 1 to 19 positive lymph nodes. The
results of the entire tumor collective are summarized in
Table1.
Gemcitabine
60
(ng/ml)
0 months) than for patients with moderate/strong positive
Apoptotic cells (%)
40 25
50
100
20
0 tion), chemotherapy, grading, pT category, pN category,
FG L3.6pl FGIFIT3 L3.6pl Gres
Fig.3Apoptotic activity of the different cell lines in correlation to
IFIT3. Gemcitabine was used as 0, 25, 50, and 100ng/ml concentra-
tions to treat the FG and its IFIT3 overexpressed variant as well as
L3.6pl and its corresponding gemcitabine resistant cells. The apop-
totic cells were decreased in IFIT3 overexpressed variant as com-
pared to FG. The apoptotic pattern was similar in FG IFIT3 over
expressed variants with L3.6pl gemcitabine resistant cells
13
J Cancer Res Clin Oncol
Immunohistochemistry
The expression was scored semi-quantitatively by a 4-tier
scale (0: negative; 1: weak; 2: moderate; 3: strongly posi-
tive; Fig.4) and was further set up into a 2-tier system (0/1:
negative/weak; vs 2/3: moderate/strong positive) for sta-
tistical analysis. According to the scoring, low (negative/
weak) expression of IFIT3 was detected in 172 (67.7%) and
high (moderate/strong positive) expression was observed in
82 (32.3%) specimens.
Immunohistochemistry andclinicpathological
parameters
Percentages of IFIT3 expression were calculated for corre-
lation with location and year of pancreatic resection, age,
sex, tumor resection margin (R-classification), chemother-
apy, grading, and pT and pN categories (Table1). None of
the tested variables showed a statistically significant corre-
lation with the expression of IFIT3.
Survival analysis
At the time of last follow-up, 231 patients were dead and
23 were alive. The median follow-up time for the whole
group was 18 months. 26 patients had survived for more
than 5 years; two patients for more than 10 years. The 5-
and 10-year survival rates of all patients were 11 and 5%,
respectively, the median survival time was 18 months.
After R0 resection, 5- and 10-year survival rates were 14
and 5%; after R1 resection, the 5-year survival rate was 5%.
None of the patients with positive margins lived 10 years or
longer. Positive lymph nodes in resected specimen reduced
5- and 10-year survival rates from 17% and 119% and 3%,
respectively. Median survival time for patients with tumors
with negative/weak expression of IFIT3 was longer (19.9
expression (16.3 months). In addition, 5-year survival rates
were better for patients with tumors with negative/weak
expression of IFIT3 than for patients with tumors with
moderate/strong positive expression (14 vs. 7%). 10-year
survival rates were equal (4%). Observed survival rate was
analyzed in dependence of location and year of pancreatic
resection, age, sex, tumor resection margin (R-classifica-
and expression of IFIT3. The results are shown in Table2.
The majority of patients (178; 70%) received adjuvant
therapy, including gemcitabine, either as monotherapy or in
combination with radiotherapy and/or other agents, includ-
ing 5-fluorouracil, oxaliplatin, and cisplatin. In the analy-
sis restricted to patients who received adjuvant chemo-
therapy, we saw a statistically significant better survival in
cases with negative or weak expression of IFIT 3, which
J Cancer Res Clin Oncol

Table1Correlation of ITEM Total Expression of IFIT3

expression of IFIT3 with
clinical and pathological Negative/weak Intermediate/strong
parameters
Number % Number %

Total 254 172 67.7 82 32.3

Clinic
Jena 106 70 66.0 36 34.0
Munich 148 102 68.9 46 31.1
Year of resection
Before 2007 128 79 61.7 49 38.3
2007 and later 126 93 73.8 33 26.2
Sex
Male 132 86 65.2 46 34.8
Female 122 86 70.5 36 29.5
Age at operation
<70 years 161 111 68.9 50 31.1
70 years and more 93 61 65.6 32 34.4
R classification
R0 187 127 67.9 60 32.1
R1 67 45 67.2 22 32.8
Grade
Low grade 88 63 71.6 25 28.4
High grade 166 109 65.7 57 34.3
Chemotherapy
No chemotherapy 76 51 67.1 25 32.9
Chemotherapy 178 121 68.0 57 32.0
pT category
pT0/1 9 4 44.4 5 55.6
pT2/3/4 245 168 68.6 77 31.4
pN category
pN 0 77 51 66.2 26 33.8
pN 1 177 121 68.4 56 31.6

is supporting the theory that high expression of IFIT3 may
cause chemotherapy resistance (Fig.5a). We did a further
analysis on the subgroup of 71 patients who received radio-
chemotherapy. The results were almost identical (Fig.5b).
The difference in observed survival again was statistically
significant (p=0.022).
Discussion
Even after curative resection, the prognosis of patients
with PDAC remains poor. Reported 5-year survival
rates after pancreatic resection are still below 20% (Dis-
tler etal. 2013; Ferrone etal. 2012). This is in concord-
ance with our study, half of the patients died within less
than 2 years after pancreatic resection. Comparable data
are published by others (Dusch et al. 2014). Numerous
efforts have been made by surgeons and oncologists to
improve the results, but till now, neither extension of the
surgical procedure nor pre- or postoperative radiation or
chemotherapy have pushed survival rates markedly or
reduced rates of recurrence. After neo-adjuvant chemo-
radiation followed by pancreatic resection, a median sur-
vival time of 31 months is reported (Varadhachary etal.
2008) for 52 patients who completed chemo-radiation,
but in many other studies with neo-adjuvant therapy,
median survival times remain less than 2 years (Polistina
et al. 2014). Different adjuvant regimens have been rec-
ommended for adjuvant therapy, because there is some
evidence that adjuvant therapy can improve postoperative
survival (Mayo et al. 2010). However, improvements in
survival rates of PDAC by adjuvant treatment are moder-
ate, regardless of the substance or combination of sub-
stances used. One can assume that this is attributable to
the excessive chemo-resistance which characterizes pan-
creatic cancer (Chiorean and Coveler 2015).

13
 J Cancer Res Clin Oncol

Fig.4Respective pictures
of the immunohistochemical
assessment of IFIT3 staining
in PDAC. Negative staining of
tumor cells (0), weakly positive
(1), moderately positive (2),
strongly positive (3), 400-fold
magnification, and cytoplas-
matic staining

Table2Overall survival Item Overall survival univariate analysis Overall survival multivariate analysis
depending on clinical and
pathological variables p HR p HR

Clinic 0.766 0.961 (0.7401.248) Not included

Year of resection 0.447 1.106 (0.8521.436) Not included
Sex 0.645 0.941 (0.7261.220) Not included
Age at resection 0.485 1.100 (0.8431.435) Not included
Chemotherapy 0.522 1.097 (0.8271.455) Not included
R-classification 0.010 1.466 (1.0961.961) 0.074 1.307 (0.9741.753)
Grade 0.000 1.790 (1.3572.360) 0.001 1.616 (1.2182.145)
pT category 0.029 2.313 (1.0884.918) 0.025 2.407 (1.1165.191)
pN category 0.007 1.490 (1.1181.985) 0.026 1.396 (1.0401.872)
IFIT3 expression 0.066 1.295 (0.9831.706) 0.021 1.391 (1.0511.841)

Although some results of research on genetic signa-
tures of PDCA are promising (Stratford et al. 2010), till
now, most of them are not adopted in clinical routine. We
recently reported that IFIT3 is up-regulated in the aggres-
sive pancreatic cancer cell line L3.6pl compared with
its less aggressive cell line of origin, COLO357FG and
enhances tumor growth, angiogenesis, metastasis, and
chemo-resistance of PDAC cells (Niess et al. 2015a, b).
In this study, we further confirmed the incidence of IFIT3
with in vitro induced chemotherapy resistance in gemcit-
abine resistant cell variant with low response of apoptotic
effect against gemcitabine.
These findings could help to identify patients with high
risk of local or systemic tumor recurrence after surgical
therapy and to choose patients for adjuvant therapy who
have a good chance that their PDCA will respond to
chemotherapy.
In a second step, we analyzed the impact of low and high
expression of IFIT3 on the protein level, using TMAs of
resected specimens of PDAC. We found that the expression
of IFIT3 was uncorrelated with standard prognostic factors
like R classification, pN category, and pT category. How-
ever, high expression of IFIT3 was an independent predic-
tor of reduced survival besides positive margins, involved
lymph nodes, and advanced T-category. Our in vitro experi-
ments supported the important role of IFIT3 in tumor pro-
gression in PDACs with a high expression of IFIT3 in gem-
citabine resistant variant and more anti-apoptotic cell rate.

13
J Cancer Res Clin Oncol
Fig.5Observed survival of patients who received a chemotherapy or b radio-chemotherapy dependent on expression of IFIT3. Univariate anal-
ysis (KaplanMeier curves and log-rank tests). Crossed lines indicate censored cases)
Interestingly, the gemcitabine resistant cell line has the
same low apoptotic rate than the cell line with high IFIT3
expression. One possible way for targeted therapy may be
to evaluate the IFIT3 expression in patients with PDAC.
If the specimen of the patient shows low or no expression
of IFIT3, they might respond better to chemotherapy (e.g.,
gemcitabine) than patients with higher IFIT3 expression.
This subgroup might benefit from gemcitabine therapy.
Further studies are needed to confirm this hypothesis.
To our best knowledge, this is the first time that the role
of IFIT3 in prognosis of PDAC patients and in chemo-
therapy resistance was described. Therefore, we deduced
that modulation of IFIT3 might provide a new strategy for
PDAC therapeutic and diagnostic procedures.
Acknowledgements The authors appreciated Mrs. Andrea Sendel-
hofert for her expertise and technical assistance in tissue microarray
immunohistochemistry staining, Dr Gerald Assmann for his support
on paraffin samples collection and Dr. Gabriele Schubert-Fritschle
from the Munich tumor registry for assistance in completing the fol-
low-up information.
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict
of interest.
Ethical approval This article does not contain any studies with
human participants or animals performed by any of the authors.
References
Carmichael J (1998) The role of gemcitabine in the treatment of other
tumours. Br J Cancer 78(Suppl 3):2125
Chiorean EG, Coveler AL (2015) Pancreatic cancer: optimizing treat-
ment options, new, and emerging targeted therapies. Drug Des
Dev Ther 9:35293545. doi:10.2147/DDDT.S60328
Distler M, Ruckert F, Hunger M, Kersting S, Pilarsky C, Saeger HD,
Grutzmann R (2013) Evaluation of survival in patients after pan-
creatic head resection for ductal adenocarcinoma. BMC Surg
13:12. doi:10.1186/1471-2482-13-12
Dusch N, Weiss C, Strobel P, Kienle P, Post S, Niedergethmann M
(2014) Factors predicting long-term survival following pancre-
atic resection for ductal adenocarcinoma of the pancreas: 40
years of experience. J Gastrointest Surg Off J Soc Surg Aliment
Tract 18(4):674681. doi:10.1007/s11605-013-2408-x
Fensterl V, Sen GC (2011) The ISG56/IFIT1 gene family. J Interferon
Cytokine Res Off J Int Soc Interferon Cytokine Res 31(1):7178.
doi:10.1089/jir.2010.0101
Fensterl V, White CL, Yamashita M, Sen GC (2008) Novel charac-
teristics of the function and induction of murine p56 family pro-
teins. J Virol 82(22):1104511053. doi:10.1128/JVI.01593-08
Ferrone CR, Pieretti-Vanmarcke R, Bloom JP, Zheng H, Szymonifka
J, Wargo JA, Thayer SP, Lauwers GY, Deshpande V, Mino-
Kenudson M, Fernandez-del Castillo C, Lillemoe KD, War-
shaw AL (2012) Pancreatic ductal adenocarcinoma: long-term
survival does not equal cure. Surgery 152(3 Suppl 1):S4349.
doi:10.1016/j.surg.2012.05.020
Hertzog P, Forster S, Samarajiwa S (2011) Systems biology of inter-
feron responses. J Interf Cytokine Res Off J Int Soc Interferon
Cytokine Res 31(1):511. doi:10.1089/jir.2010.0126
Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ (2009) Cancer
statistics, 2009. CA Cancer J Clin 59(4):225249. doi:10.3322/
caac.20006
Knosel T, Emde A, Schluns K, Chen Y, Jurchott K, Krause M, Dietel
M, Petersen I (2005) Immunoprofiles of 11 biomarkers using tis-
sue microarrays identify prognostic subgroups in colorectal can-
cer. Neoplasia 7(8):741747. doi:10.1593/neo.05178
MacMicking JD (2012) Interferon-inducible effector mechanisms in
cell-autonomous immunity. Nat Rev Immunol 12(5):367382.
doi:10.1038/nri3210
Mayo SC, Austin DF, Sheppard BC, Mori M, Shipley DK, Billings-
ley KG (2010) Adjuvant therapy and survival after resection of
pancreatic adenocarcinoma: a population-based analysis. Cancer
116(12):29322940. doi:10.1002/cncr.25082
Michael M, Moore M (1997) Clinical experience with gemcitabine in
pancreatic carcinoma. Oncology (Williston Park) 11(11):1615
1622; (discussion 1622, 1625-1617)
Michl P, Gress TM (2013) Current concepts and novel targets in
advanced pancreatic cancer. Gut 62(2):317326. doi:10.1136/
gutjnl-2012-303588
13

Niess H, Camaj P, Mair R, Renner A, Zhao Y, Jackel C, Nelson PJ,
Jauch KW, Bruns CJ (2015a) Overexpression of IFN-induced
protein with tetratricopeptide repeats 3 (IFIT3) in pancreatic can-
cer: cellular pseudoinflammation contributing to an aggressive
phenotype. Oncotarget 6(5):33063318
Niess H, Camaj P, Renner A, Ischenko I, Zhao Y, Krebs S, Mysliwietz
J, Jackel C, Nelson PJ, Blum H, Jauch KW, Ellwart JW, Bruns
CJ (2015b) Side population cells of pancreatic cancer show
characteristics of cancer stem cells responsible for resistance
and metastasis. Targeted oncology 10(2):215227. doi:10.1007/
s11523-014-0323-z
Polistina F, Di Natale G, Bonciarelli G, Ambrosino G, Frego M
(2014) Neoadjuvant strategies for pancreatic cancer. World J
Gastroenterol WJG 20(28):93749383. doi:10.3748/wjg.v20.
i28.9374
Sadler AJ, Williams BR (2008) Interferon-inducible antiviral effec-
tors. Nat Rev Immunol 8(7):559568. doi:10.1038/nri2314
Sobin LH, Gospodarowicz MK, Wittekind C, International Union
against Cancer. (2010) TNM classification of malignant tumours.
7thedn. Wiley-Blackwell, Chichester
Stratford JK, Bentrem DJ, Anderson JM, Fan C, Volmar KA, Mar-
ron JS, Routh ED, Caskey LS, Samuel JC, Der CJ, Thorne LB,
Calvo BF, Kim HJ, Talamonti MS, Iacobuzio-Donahue CA,
13
J Cancer Res Clin Oncol
Hollingsworth MA, Perou CM, Yeh JJ (2010) A six-gene signa-
ture predicts survival of patients with localized pancreatic ductal
adenocarcinoma. PLoS Med 7 (7):e1000307. doi:10.1371/jour-
nal.pmed.1000307
Van den Broeck A, Vankelecom H, Van Eijsden R, Govaere O, Topal
B (2012) Molecular markers associated with outcome and metas-
tasis in human pancreatic cancer. J Exp Clin Cancer Res CR
31:68. doi:10.1186/1756-9966-31-68
Varadhachary GR, Wolff RA, Crane CH, Sun CC, Lee JE, Pisters PW,
Vauthey JN, Abdalla E, Wang H, Staerkel GA, Lee JH, Ross
WA, Tamm EP, Bhosale PR, Krishnan S, Das P, Ho L, Xiong
H, Abbruzzese JL, Evans DB (2008) Preoperative gemcitabine
and cisplatin followed by gemcitabine-based chemoradiation
for resectable adenocarcinoma of the pancreatic head. J Clin
Oncol Off J Am Soc Clin Oncol 26(21):34873495. doi:10.1200/
JCO.2007.15.8642
Wacher C, Muller M, Hofer MJ, Getts DR, Zabaras R, Ousman SS,
Terenzi F, Sen GC, King NJ, Campbell IL (2007) Coordinated
regulation and widespread cellular expression of interferon-
stimulated genes (ISG) ISG-49, ISG-54, and ISG-56 in the cen-
tral nervous system after infection with distinct viruses. J Virol
81(2):860871. doi:10.1128/JVI.01167-06