You are on page 1of 5

>Citrus_medica chloroplast rbcL gene for ribulose-1,5-bisphosphate

carboxylase/oxygenase large subunit, partial cds


TTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTG
GCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGG
TACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTG
CTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTT
ACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTA
TACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGG
GATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTT
GACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGC
TCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGC
TAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAAT
ACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACA
GAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAG
TAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGAT
CGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGT
TTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTATTACAATTTGGTGGAGGAACTTTAGGACACCCTT
GGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTT
GCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Citrus_x paradisi chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
GACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGG
GGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACA
AAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTT
TTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACG
TCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATA
AATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGG
GCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTG
GAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGA
ATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCAT
GACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCA
CCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGT
CTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGAT
TTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGT
TATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTATTAC
AATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGT
GTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Citrus_sinensis chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds, cultivar: fukuhara orange
TGTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCT
TGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACT
GGTACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGT
TGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGT
TTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCG
TATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTT
GGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGAC
TTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAA
GCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAAT
GCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAA
ATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGA
CAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTAC
AGTAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAG
ATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCAC
GTTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTATTACAATTTGGTGGAGGAACTTTAGGACACCC
TTGGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATC
TTGCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Clymenia_polyandra chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
GATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA
GCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAGCTGTGTGGACCG
ATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATA
TGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATT
TGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTCCAAGGCCCGC
CTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTG
GGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAA
CGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCGCAAGCTGAAA
CAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGA
GAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCG
AGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTC
GTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTTGAGGGGGAA
AGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTATTTATTTCAC
TCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCTGCGTTGACAG
AGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGCGCTGTA
GCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAAATTAT
CCGGGAGGCTAGCAAATGGAG
>Fortunella_margarita chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
CGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAG
TAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAGCT
GTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAA
TCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGG
GTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTC
CAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAA
ACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAG
ATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCG
CAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGT
CTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTC
ATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGT
ATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATGTTCACGCCGGTACAGTAGTAGGTAAACT
TGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTA
TTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCT
GCGTTGACAGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACC
CGGCGCTGTAGCTAATCGAGTATCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTA
ATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Fortunella_polyandra chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
CAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCAT
TCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGG
ACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGA
AGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCA
TTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAA
ACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTAC
TATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTA
CCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTAT
AAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAG
GGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCT
TGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAAT
CATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATGTTCACGCCGGTACAGTAGTAGG
TAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCC
GCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCAT
ATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAA
TGCACCCGGCGCTGTAGCTAATCGAGTATCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTG
AAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Fortunella_hindsii chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds, tetraploid>Fortunella_hindsii
chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large
subunit, partial cds, diploid
TGTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCT
TGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACT
GGTACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGT
TGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGT
TTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCG
TATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTT
GGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGAC
TTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAA
GCTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAAT
GCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAA
ATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGA
CAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATGTTCACGCCGGTAC
AGTAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAG
ATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCAC
GTTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCC
TTGGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTATCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATC
TTGCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Microcitrus_warburgiana chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
GTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTT
GGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTG
GTACCTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTT
GCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTT
TACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTATACGTCTAGAGGATCTACGAATCCCTCCTGCGT
ATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTG
GGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACT
TGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAG
CTCTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATG
CTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAA
TACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGAC
AGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACA
GTAGTAGGTAAACTTGAGGGGGAAAGAGAAATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGA
TCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACG
TTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATGCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCT
TGGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCT
TGCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Microcitrus_inodora chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
GGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGC
AGCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTA
CCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCT
GGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTAC
TTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTATACGTCTAGAGGATCTACGAATCCCTCCTGCGTATA
CTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGA
TGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGA
CTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTC
TTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTA
AAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATAC
TAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGA
AGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTA
GTAGGTAAACTTGAGGGGGAAAGAGAAATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCG
AAGCCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTT
GGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATGCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGG
GGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGC
TCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Microcitrus_australasica chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
CAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCAT
TCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGG
ACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGA
AGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCA
TTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTATACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAA
ACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTAC
TATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTA
CCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCGTATTTTGTGCGGAAGCTCTTTAT
AAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAG
GGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTACCT
TGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAAT
CATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGG
TAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCC
GTGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCAT
ATGCCTGCGTTGACAGAGATCTTTGGAGATGATGCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAA
TGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAAGGACGCGATCTTGCTCGTG
AAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Eremocitrus_glauca chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
CGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAG
TAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACT
GTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAA
TCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGG
GTAATGTATTTGGTTTCAAAGCACTGCGCGCTATACGTCTAGAGGACCTACGAATCCCTCCTGCGTATACTAAAACTTTC
CAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAA
ACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAG
ATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCTCTTTATAAAGCG
CAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGT
CTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTC
ATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGT
ATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACT
TGAGGGGGAAAGAGAAATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGTGGTA
TTTATTTCACTCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCT
GCGTTGACAGAGATCTTTGGAGATGATGCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACC
CGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTA
ATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Atalantia_roxburghiana chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
TCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGAGTCCCACCCGAGGAAG
CGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGT
TACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGA
CCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTA
TACGTCTAGAGGATCTACGAATCCCTCCTGCGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGA
GATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTATGG
TAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGC
GTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTAC
TTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAAT
GCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACA
TCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGT
CTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGT
TGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAG
GTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTA
CTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGC
ATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGCGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Poncirus_trifoliata chloroplast rbcL gene
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCC
TGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGG
GGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTAC
AAAGGGCGATGCTACAACATTGAGCCCGTTGCTGGAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCT
TTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTAC
GTCTAGAGGATCTACGAATCCCTCCTGAGTATACTAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGAT
AAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAAACCTAAACTGGGGTTATCCGCGAAGAATTATGGTAG
GGCGGTTTATGAATGTCTACGCGGTGGACTTGACTTTACTAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTT
GGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTG
AATGCTACTGCAGGGACATGCGAAGAAATGCTAAAAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCA
TGACTACTTAACAGGGGGATTCACCGCAAATACTACCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCC
ACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTG
TCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGA
TTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATACCAGGTG
TTTTACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTACTA
CAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACCCGGCGCGGTAGCTAATCGAGTAGCTCTAGAAGCATG
TGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAGTCCTG
AACTGGCTGCTGCTTGTGAAATCTGGAAGTCGATCAAATTCGAATTTGCCGCAATGGATACTTTGTAA
>Atalantia_monophylla chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
GATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCA
GCATTCCGAGTAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTAC
CTGGACAGCTGTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGCCCGTTGCTG
GAGAAGAGAATCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACT
TCCATTGTGGGTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTTCGTCTAGAGGATCTACGAATCCCTCCTGCGTATAC
TAAAACTTTCCAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGAT
GTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGAC
TTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACT
TTATAAAGCGCAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAA
AAAGGGCTGTCTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACT
AGCTTGGCCCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAA
GAATCATGGTATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAG
TAGGTAAACTTGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGA
AGCCGCGGTATTTATTTCACGCAAGATTGGGTCTCTATACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTG
GCATATGCCTGCGTTGACAGAGATCTTTGGAGATGATTCCGTACTACAATTTGGTGGAGGAACTTTAGGACACCCTTGGG
GAAATGCACCCGGCGCTGTAGCTAATCGAGTATCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCT
CGCGAAGGTAATGAAATTATCCGGGAGGCTAGCAAATGGAG
>Merrillia_caloxylon chloroplast rbcL gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase large subunit, partial cds
CGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTAGCAGCATTCCGAG
TAACTCCTCAGCCCGGAGTTCCACCCGAGGAAGCGGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACCTGGACAGCT
GTGTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACAACATTGAGTCCGTTGCTGGAGAAGAGAA
TCAATATATATGTTATGTAGCTTACCCGTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGG
GTAATGTATTTGGTTTCAAAGCACTGCGCGCTCTACGTCTAGAGGATCTACGAATCCCTCCTGCGTATTCTAAAACTTTC
CAAGGCCCGCCTCACGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGTCCCCTGTTGGGATGTACTATTAA
ACCTAAACTGGGGTTATCCGCTAAGAATTATGGTAGGGCGGTTTATGAATGTCTACGTGGTGGACTTGACTTTACCAAAG
ATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGGGACCGTTTCTTATTTTGTGCGGAAGCACTTTATAAAGCG
CAAGCTGAAACAGGTGAAATCAAAGGTCATTACTTGAATGCTACTGCAGGGACATGCGAAGAAATGATAAAAAGGGCTGT
CTTTGCCAGAGAGTTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGCTTGGCTC
ATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGT
ATGCACTTTCGTGTACTAGCTAAAGCTTTGCGTCTGTCTGGTGGAGATCATATTCACGCCGGTACAGTAGTAGGTAAACT
TGAGGGGGAAAGAGACATAACCTTGGGATTTGTTGATTTACTACGTGATGATTTTGTTGAAAAAGATCGAAGCCGCGGTA
TTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTATACCTGTGGCTTCCGGGGGTATTCACGTTTGGCATATGCCT
GCGTTGACAGAGATCTTTGGAGATGATTCCGTACTCCAATTTGGTGGAGGAACTTTAGGACACCCTTGGGGAAATGCACC
CGGCGCTGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGCGAAGGTA
ATGAAATTATCCGGGAGGCTAGCAAATGGAG