Resource

A Versatile Tool for Live-Cell Imaging and Super-

Resolution Nanoscopy Studies of HIV-1 Env
Distribution and Mobility
Graphical Abstract Authors
Volkan Sakin, Janina Hanne,
Jessica Dunder, ...,
Hans-Georg Kra usslich,
Edward A. Lemke, Barbara Mu ller

Correspondence
barbara_mueller@med.uni-heidelberg.de

In Brief
Sakin et al. show that HIV-1 Env can be
engineered to incorporate non-canonical
amino acids and subsequently click
labeled with different tetrazine-coupled
fluorophores. This minimally invasive and
flexible labeling strategy allows studying
nanoscale organization and mobility of
Env at the plasma membrane by STED
nanoscopy and live-cell imaging.

Highlights
d Non-canonical amino acids (ncAAs) were incorporated into
the HIV-1 Env glycoprotein

d EnvncAA retained glycosylation, membrane localization, and

fusogenic activity

d Engineered EnvncAA can be click labeled with tetrazine-

coupled fluorophores

d Directly labeled EnvncAA provides a tool for studying Env

distribution and mobility

Sakin et al., 2017, Cell Chemical Biology 24, 635645

May 18, 2017 2017 Elsevier Ltd.
http://dx.doi.org/10.1016/j.chembiol.2017.04.007
Cell Chemical Biology
Resource
A Versatile Tool for Live-Cell Imaging
and Super-Resolution Nanoscopy Studies
of HIV-1 Env Distribution and Mobility
Volkan Sakin,1 Janina Hanne,1,3 Jessica Dunder,1 Maria Anders-Osswein,1 Vibor Laketa,1,4 Ivana Nikic
Hans-Georg Kra usslich,1,4 Edward A. Lemke,2 and Barbara Mu
ller1,6,*
1Department of Infectious Diseases, Virology, University Hospital Heidelberg, Im Neuenheimer Feld 324, 69120 Heidelberg, Germany
2Structural and Computational Biology Unit, Cell Biology and Biophysics Unit, EMBL, 69117 Heidelberg, Germany
3Optical Nanoscopy Division, German Cancer Research Center
4German Center for Infection Research, Partner Site Heidelberg
69120 Heidelberg, Germany
5Present address: Werner Reichardt Center for Integrative Neuroscience, University of Tu bingen, 72076 Tu
6Lead Contact
*Correspondence: barbara_mueller@med.uni-heidelberg.de
http://dx.doi.org/10.1016/j.chembiol.2017.04.007
SUMMARY
The envelope glycoproteins (Env) of HIV-1 mediate
cell entry through fusion of the viral envelope with a
target cell membrane. Intramembrane mobility and
clustering of Env trimers at the viral budding site
are essential for its function. Previous live-cell and
super-resolution microscopy studies were limited
by lack of a functional fluorescent Env derivative,
requiring antibody labeling for detection. Introduc-
tion of a bio-orthogonal amino acid by genetic code
expansion, combined with click chemistry, offers
novel possibilities for site-specific, minimally inva-
sive labeling. Using this approach, we established
efficient incorporation of non-canonical amino acids
within HIV-1 Env in mammalian cells. The engineered
protein retained plasma membrane localization,
glycosylation, virion incorporation, and fusogenic
activity, and could be rapidly and specifically labeled
with synthetic dyes. This strategy allowed us to
revisit Env dynamics and nanoscale distribution at
the plasma membrane close to its native state,
applying fluorescence recovery after photo bleach-
ing and STED nanoscopy, respectively.
INTRODUCTION
Productive entry of HIV-1 into target cells is mediated by the viral
envelope glycoprotein (Env), which specifically interacts with the
CD4 receptor on the host cell plasma membrane. Conforma-
tional changes occurring after CD4 binding expose a binding
site for a co-receptor molecule (CCR5 or CXCR4). This event trig-
gers further conformational rearrangements, resulting in fusion
of the viral lipid envelope with the host cell membrane and cyto-
solic release of the viral core (reviewed by Checkley et al., 2011;
Wilen et al., 2012).
Cell Chemical Biology 24, 635645, May 18, 2017 2017 Elsevier Ltd. 635

,2,5
bingen, Germany
Functional HIV-1 Env is a heterotrimeric complex of dimers
composed of a surface subunit (gp120), which interacts with
receptor and co-receptor molecules, and a transmembrane sub-
unit (gp41) that serves as membrane anchor and promotes
membrane fusion. Env is synthesized as a polyprotein precursor
(gp160) that traffics to the plasma membrane via the secretory
pathway. A cellular furin-like protease cleaves the precursor
into gp120 and gp41. Both subunits are heavily glycosylated
with 2535 potential N-glycosylation sites (Asn-X-Ser/Thr) per
Env molecule, dependent on the virus strain.
Mobility and clustering of Env molecules on the plasma mem-
brane or on the viral particle are intrinsically linked to Env virion
incorporation, particle infectivity, and the establishment of viro-
logical synapses for cell-cell transmission (reviewed by Zhong
et al., 2013). Once heterotrimers reach the plasma membrane,
they may either be recruited by the inner structural polyprotein
Gag to nascent HIV-1 assembly sites and incorporated into the
budding virus, or rapidly internalized by clathrin-mediated endo-
cytosis (reviewed by Checkley et al., 2011). In contrast to surface
glycoproteins of many enveloped viruses, HIV-1 Env is incorpo-
rated into virions in low and variable numbers, with estimates in
the range of 714 trimers per particle on average for lab-adapted
virus strains (Chertova et al., 2002; Chojnacki et al., 2012; De-
Santis et al., 2016; Zhu et al., 2003, 2006).
HIV-1 Env incorporation into budding virions is mediated
by the matrix domain of the Gag polyprotein (Dorfman et al.,
1994; Tedbury and Freed, 2014; Yu et al., 1992). Although mo-
lecular details of this process are still controversial, the advent
of super-resolution fluorescence microscopy (SRFM) techniques
opened novel possibilities to study the nanoscale organization of
Env and Gag both on the surface of virus expressing cell as
well as on the viral envelope (reviewed by Hanne et al., 2016).
It was recently shown by SRFM that Env is specifically recruited
to the vicinity of HIV-1 assembly sites on the plasma membrane
dependent on its cytoplasmic tail (CT) (Muranyi et al., 2013; Roy
et al., 2013; Tedbury et al., 2013), and accumulates in larger,
apparently Gag-induced, membrane microdomains surrounding
the nascent virus bud (Muranyi et al., 2013). Complementary,
fluorescence recovery after photo bleaching (FRAP) experiments
investigating the mobility of Env showed that, whereas Env
proteins lacking the CT are relatively mobile on the plasma mem-
brane, full-length Env is trapped and immobile at or near Gag
assembly sites (Roy et al., 2013).
The studies summarized above employed indirect immuno-
labeling with antibodies or Fab fragments for Env detection.
This approach hampers real-time live analyses and adds sub-
stantial molecular mass (25150 kDa) to the protein of interest,
increasing its hydrodynamic radius by 24 nm and impairing
effective localization precision in SRFM. Variants of HIV-1 Env
tagged with an optimized version of EGFP (Nakane et al.,
2015) or the self-staining tetracysteine tag (Pereira et al., 2011)
were reported, but were not further exploited for studying
Env dynamics and are of limited use for SRFM. Introduction of
the stainable A1- and Q3-peptide tags into HIV-1 Env
represented a major advancement, which allowed probing the
molecular dynamics of the protein by fluorescence resonance
energy transfer (Munro et al., 2014). However, these tags still
add 612 amino acids and their modification with fluorophores
by an exogenously added cognate enzyme is slow. Establish-
ment of genetic labeling strategies that minimize modification
size while allowing rapid, specific labeling with synthetic dyes,
thereby providing flexibility to use various advanced microscopy
techniques (e.g., stimulated emission depletion [STED] nano-
scopy or multi-color single-molecule localization microscopy),
would thus be highly advantageous.
Minimally invasive site-specific labeling by insertion of single
non-canonical amino acid residues (ncAAs) with bio-orthogonal
reactivity, followed by click labeling, fulfills these requirements
(reviewed by Lang and Chin, 2014; Nikic
and Lemke, 2015, see
Figure 1A). This strategy will likely become an important tool in
virology (reviewed by Sakin et al., 2016), but its application in
eukaryotic cells is still under methodological development and
more challenging than traditional labeling approaches. For these
reasons, only very few recent studies explored the use of this
technology for labeling of viral proteins (Kelemen et al., 2016;

et al., 2014; Zheng et al., 2015) and the
Lin et al., 2013; Nikic
approach has not yet been employed for fluorescent labeling
of HIV-1 proteins.
Here, we developed and applied a site-specific, minimally
invasive, and versatile labeling strategy for HIV-1 Env based on
genetic code expansion and click chemistry. A single bio-
orthogonal amino acid residue was introduced using amber
stop codon suppression. Engineered Env molecules on the
plasma membrane were click labeled with different tetrazine-
functionalized fluorophores suitable for fast strain promoted
Diels-Alder cycloadditions (SPDACs). This approach permits
analysis of Env mobility and clustering by live-cell imaging and
nanoscopy without the need for immunostaining.
RESULTS
Modification of HIV-1 Env by Genetic Code Expansion at
Three Different Sites
We set up a system for genetic code expansion in eukaryotic cells
(Figure 1A). For this, we employed the previously described
plasmid ptRNApyl/pylRSAF, encoding an engineered version of
the orthogonal aminoacyl-tRNA synthetase from Methanosarcina
mazei, as well as one copy of a cognate tRNACUA (Borrmann et al.,
636 Cell Chemical Biology 24, 635645, May 18, 2017
2012; Plass et al., 2011, 2012), which recognizes the amber
stop codon UAG. As a benchmark for optimal amber suppression
efficiency, HEK293T cells were co-transfected with ptRNApyl/
pylRSAF and a well-established control construct (Plass et al.,
2012) encoding an mCherry-eGFP fusion in which the codon for
residue Y39 in the eGFP moiety is replaced by an amber stop
codon. Immunoblot analysis of cell lysates indicated a high effi-
ciency of amber suppression in the presence of the clickable
ncAA endo Bicyclo [6.1.0] nonyne-L-Lysine (BCN-Lys), with the
full-length product detected at similar levels as the truncated
form (generally >40% of total aGFP reactive bands; see example
in Figure S1).
We then explored three different sites for insertion of TAG
codons within variable loop (V) regions of the HIV-1 env gene:
two sites in V4, following amino acids 402 or 407, and one in V5,
following amino acid 457 (Figure 1B). These positions were previ-
ously shown to tolerate the insertion of small peptide tags (Munro
et al., 2014; Pantophlet et al., 2009). A TAG codon was inserted at
one of the respective positions in a plasmid encoding only the
Env protein (pEnv), as well as in the full proviral plasmid pNL4-3.
Suppression efficiency was analyzed by transfecting HEK293T
cells with expression plasmids encoding Env402TAG, Env407TAG,
Env457TAG, or wild-type Env (Env(WT)) in the presence or absence
of the orthogonal tRNApyl/pylRSAF pair and/or BCN-Lys added
to the growth medium. Cell lysates were analyzed by immunoblot-
ting with agp120 antiserum (Figure 1C). Two reactive proteins rep-
resenting the glycoprotein precursor and mature gp120, respec-
tively, were detected in cells expressing Env(WT) (Figure 1C). In
contrast, only products of lower molecular mass, presumed to
correspond to the truncated variants, were detected upon trans-
fection of EnvTAG encoding plasmids in the absence of tRNApyl/
pylRSAF and/or ncAA (Figure 1C). Addition of BCN-Lys to the cul-
ture medium resulted in the expression of bands co-migrating with
WT gp160 and gp120; intensities of the respective bands in immu-
noblots were very weak, however (Figure 1C). Band intensities
corresponding to gp120 and gp160 together amounted to only
5%10% of total agp120 reactive protein. BCN-Lys was thus
successfully incorporated by amber suppression at all three posi-
tions tested, but suppression efficiencies were low.
Efficiency of amber suppression is limited by competition of
the eukaryotic release factor 1 (eRF1) with the orthogonal tRNA
for binding to UAG codons. Recently, Schmied et al. (2014) re-
ported that expression of dominant-negative eRF1 (E55D) can
increase amber suppression efficiencies. As shown in Figure 1D,
substantially improved (4-fold) suppression efficiencies were
indeed obtained in the presence of eRF1 (E55D) for all three
EnvTAG variants tested. Very weak signals corresponding to
full-length Env were occasionally observed upon eRF1 (E55D)
co-expression in samples lacking BCN-Lys, indicating that low
levels of natural amino acids may be incorporated in the absence
of ncAA. Since levels of the full-length protein were consistently
higher for Env407ncAA compared with the other two mutants (Fig-
ure 1D and data not shown), we focused on this variant in the
presence of eRF1 (E55D) for further experiments.
Engineered HIV-1 Env Localizes to the Plasma
Membrane and Retains Fusogenic Activity
We next tested whether engineered Env behaved similar to
Env(WT) with respect to glycosylation, subcellular localization,

and fusogenic activity. To compare glycosylation of Env407ncAA
with that of Env(WT), we transfected pEnv(WT) or pEnv407TAG
in the presence of the amber suppression system. Cleared
cell lysates were incubated with Endoglycosidase H (EndoH),
which removes the chitobiose core of high-mannose oligo-
saccharides and a limited number of hybrid oligosaccharides
from asparagine-linked glycoproteins, but does not cleave
complex glycans. Immunoblot analysis revealed that treatment
of Env407ncAA resulted in a faster migrating protein with an
apparent molecular mass of 8090 kDa, indistinguishable
from the corresponding Env(WT) sample (Figure 1E). Electro-
phoretic mobility of truncated Env was also increased upon En-
Figure 1. Incorporation of BCN-Lys at
Three Different Positions of the HIV-1 Env
Protein by Amber Suppression
(A) Basic experimental scheme of amber sup-
pression. The sequence TAG is inserted at the
desired position in the coding sequence of in-
terest. The modified expression plasmid is then
co-transfected together with a plasmid encoding
an engineered pyrrolysyl-tRNA synthetase
(pylRSAF), e.g., from Methanosarcina mazei, and
a cognate tRNApyl that recognizes the amber
stop codon. Growth of transfected cells in the
presence of a suitable ncAA results in incorpo-
ration of a bio-orthogonal residue at the selected
position.
(B) Scheme of HIV-1NL4-3 Env, indicating the
insertion of amber stop codons following amino
acid positions 402, 407, and 457. C1-C5, con-
stant regions; V1-V5, variable regions; HR1-HR2,
heptad repeats 1 and 2; TM, transmembrane
domain.
(C) Quantitative analysis of amber suppression in
HEK293T cells. See Figure S1 for an experiment
with an established test construct. Cells co-
transfected with the indicated EnvTAG expression
constructs and a plasmid encoding a tRNApyl/
pylRSAF pair (ptRNApyl/pylRSAF) or empty control
vector were grown in the presence or absence of
250 mM BCN-Lys. At 40 hr post-transfection (hpt),
cell lysates were harvested and analyzed by
quantitative immunoblotting using polyclonal
antiserum raised against gp120. Band intensities
were measured and used to calculate the per-
centage of intensities representing full-length
proteins relative to the total reactive bands, as
indicated at the bottom of the panel. Arrows
indicate the position of gp160 and gp120.
(D) Amber suppression efficiencies obtained upon
co-transfection of peRF1 (E55D). Experiment and
data analysis was performed as in (C). See STAR
Methods for plasmid ratios used.
(E) Analysis of Env deglycosylation. Amber sup-
pression of pEnv407TAG was performed in the
presence of peRF1 (E55D) as in (D). At 40 hpt
the cell lysates were harvested and incu-
bated with Endo H as described in the STAR
Methods. Proteins were subsequently analyzed
by quantitative immunoblotting using a polyclonal
antiserum raised against gp120. The asterisk in-
dicates partially deglycosylated truncated Env
proteins.
doH treatment (Figure 1E, asterisk), indicating partial glycosyla-
tion of the truncated form.
To test for Env plasma membrane localization, cells were
transfected with pEnv(WT) or pEnv407TAG, tRNApyl/pylRSAF,
and peRF1 (E55D) in the presence or absence of ncAA. Non-per-
meabilized cells were subjected to indirect immunostaining for
detection of Env molecules at the plasma membrane. Subse-
quently, cells were permeabilized and immunostained again
with the same primary antibody and a secondary antibody
tagged with a different fluorophore to visualize both surface-
exposed and intracellular Env pools. Env(WT) was detected at
the surface of non-permeabilized cells; upon permeabilization,
Cell Chemical Biology 24, 635645, May 18, 2017 637
Figure 2. Engineered HIV-1 Env407ncAA Localizes to the Plasma Membrane
HEK293T cells co-transfected with pEnv(WT) or pEnv407TAG, respectively, together with ptRNApyl/pylRSAF and peRF1 (E55D), were grown in the presence
(+ncAA) or absence ( ncAA) of 250 mM BCN-Lys. At 40 hpt, cells were fixed briefly and immunostained using monoclonal anti-gp120 antibody 2G12, followed by
Alexa Fluor 488-coupled secondary antibody to detect Env on the plasma membrane (Env (PM)). Cells were then permeabilized and immunostained using the
same primary antibody, followed by counter-staining with Alexa Fluor 647-coupled secondary antibody to detect total Env (intra- and extracellular). Images were
recorded by spinning disk confocal microscopy. Cyan, Hoechst staining; yellow, Alexa Fluor 488 (Env (PM)); magenta, Alexa Fluor 647 (Env (Total)). Scale bars,
10 mm. See Figures S2 and S3 for additional images and quantitation.

staining was also observed within intracellular compartments
of the secretory pathway (Figure 2, top row). In the case of
Env407TAG, only intracellular protein was detected in the
absence of ncAA (Figure 2, middle row); this pool is presumed
to represent the truncated form lacking the transmembrane
domain. Detection of the engineered protein on the cell surface
depended on the addition of ncAA to the growth medium, indi-
cating specificity of amber suppression (Figure 2, bottom row).
The fact that the intracellular pool comprised both truncated
and full-length forms prevented the quantitative assessment of
the membrane-trafficking efficiency of the engineered variant.
Nevertheless, while plasma membrane levels varied from cell
to cell, mean immunostaining levels in the range of 50%75%,
compared with Env(WT) expressing cells, were revealed by
microscopy or flow cytometry-based quantitation (Figures S2
and S3), indicating substantial amounts of Env localized at the
plasma membrane on average.
Functionality of the engineered protein was determined using
a cell-cell fusion assay. HIV-1 Env expressed on the cell surface
can promote cell fusion with neighboring cells carrying CD4 and
the respective co-receptor (CXCR4 in the case of HIV-1NL4-3), re-
sulting in the formation of multinucleated syncytia (Lifson et al.,
1986). As shown in Figure 3, expression of Env407ncAA in HeLaP4
cells, which carry CD4 and CXCR4, promoted formation of multi-
nucleated syncytia carrying Env at the plasma membrane. This
phenotype was dependent on the presence of ncAA (Figure 3A).
Similar results were obtained when Env(WT) or Env407ncAA were
expressed in the presence of the other HIV-1-encoded proteins
expressed from the pCHIV(Env-) construct (Figure 3B). Quantita-
tion of nuclei per syncytium (Figure 3C) revealed that syncytia
induced by Env407ncAA were somewhat smaller on average
than those observed upon Env(WT) expression, and giant syncy-
tia (>25 nuclei) were not detected for the engineered variant,
consistent with a lower amount of full-length Env407ncAA
compared with Env(WT) detected in cell lysates by quantitative
immunoblot (Figure 1C) and lower Env407ncAA levels on the sur-
face of individual cells (Figures S2B and S3).
HIV-1 Particles Carrying Engineered Env Retain
Infectivity
To determine whether virus infectivity was retained upon Env
modification, all three engineered proteins were employed for
pseudotying of an Env-deficient HIV-1 derivative (NL4-3(Env-)).
Pseudotyped virions were prepared from cells co-transfected
with pNL4-3(Env-), ptRNApyl/pylRSAF, together with a pEnvTAG
expression plasmid or pEnv(WT) in the absence (Figure S4) or
presence (Figure 4) of eRF1 (E55D). Particles were concentrated
from the culture supernatants of cells grown in the absence or

638 Cell Chemical Biology 24, 635645, May 18, 2017


Figure 3. Engineered HIV-1 Env407ncAA Induces Syncytia Formation
in HeLaP4 Cells
(A) HeLaP4 cells were co-transfected with pEnv407TAG and ptRNApyl/pylRSAF
and grown in the presence or absence of 250 mM BCN-Lys. At 40 hpt cells
presence of BCN-Lys. Single-round infectivity was determined
by titration on TZM-bl reporter cells, and infectivity was normal-
ized to the amount of virus determined by a reverse transcriptase
activity assay (Figure 4A). Env levels and particle production
were further analyzed by immunoblot (Figures 4B and 4C).
Control experiments established that the presence of the
amber suppression system and/or BCN-Lys did not significantly
impair relative infectivity or release of particles pseudotyped with
Env(WT) under the conditions used (Figure 4A, columns 710;
Figure 4C, lanes 710).
For particles pseudotyped with Env variants carrying a stop
codon after position 402, 407, or 457, relative infectivity levels
ranging between 5% and 10% of the WT control were detected
under amber suppression conditions (Figure 4A, columns 2,
4, 6). Infectivity strictly depended on the presence of ncAA during
virus production (Figure 4A, compare columns 1, 3, 5 with 2, 4, 6),
indicating that any possible low levels of non-specific amber read-
through did not contribute to the measured infectivity. Consistent
with the reduced infectivity observed for EnvncAA-carrying virus
preparations, relative amounts of full-length Env detected for
the engineered variants in cell lysates were lower than those of
the Env(WT) control (Figure 4B), and the particle-associated
gp120 signal was too weak to be detectable for any of the mutants
(Figure 4C). Of note, the highest infectivity levels, as well as the
highest signals in immunoblot among the engineered Env variants
in cell lysates, were obtained again for Env407TAG (Figures 4A and
4B.) Very similar results were obtained when eRF1 (E55D) was
omitted, but relative infectivity levels of the variant viruses were
lower in this case (Figure S4). These findings clearly demonstrate
that HIV-1 particles carrying engineered Env were infectious. The
reduced relative infectivity (1 order of magnitude) of the particle
preparations compared with the WT control is likely explained
by the lower overall Env levels expressed and the higher variability
of relative Env content within the virus particle pool, since Env
incorporation into particles depends on efficient co-transfection
of virus-producing cells with four plasmids.
TAG codons were also inserted at the same three positions
within env in the context of the complete proviral plasmid
pNL4-3. In the case of NL4-3TAG, full-length Env expression
was undetectable in viral particles by immunoblot under our con-
ditions and infectivity was not recovered within the sensitivity
range of the reporter cell assay.
were fixed and subjected to indirect immunofluorescence using a monoclonal
agp120 antibody (2G12) and Alexa Fluor 488-coupled secondary antibody.
Images of multinuclear syncytia were recorded by spinning disk confocal
microscopy.
(B) HeLaP4 cells were co-transfected with the pEnv407TAG or pEnv(WT)
expression plasmids, together with an Env-deficient, non-infectious proviral
plasmid derivative (pcHIV(Env-)) and grown in the presence or absence of
250 mM BCN-Lys. At 40 hpt cells were fixed and stained as in (A). Images were
recorded by wide-field fluorescence microscopy. Cyan, Hoechst staining;
magenta, Alexa Fluor 488. Scale bars, 10 mm in (A and B).
(C) Scatterplot summarizing the size of Env-positive syncytia (defined here as
cells with more than one nucleus) detected in 3 independent experiments
performed as in (B). The number of syncytia (n = 172 for Env(WT) and n = 140
for Env407ncAA) analyzed per condition are given at the top of the graph. The
size of syncytia is represented as the number of nuclei present in each syn-
cytium. Magenta lines indicate median values. Statistical significance was
assessed by the Mann-Whitney U test (**p = 0.0055).
Cell Chemical Biology 24, 635645, May 18, 2017 639

(B and C) Quantitative immunoblot analysis of cell lysates (B) and virus particles (C) using the indicated polyclonal antisera. The volumes of cell lysates loaded in
(B) were adjusted to account for different expression levels (EnvncAA samples [16]: Env(WT) samples [710] = 2.5:1). Numbers above lanes refer to the
experimental conditions shown in (A). See Figure S4 for an experiment performed in the absence of eRF1 E55D.
Engineered Env Can Be Click Labeled at the Plasma
Membrane
After successful incorporation of BCN-Lys into Env, we
established conditions for labeling of the protein by a SPDAC re-
action with tetrazine-functionalized (Tet-) organic fluorophores.
To define conditions for fast and efficient labeling, we compared
incorporation and labeling efficiencies for three chemically
different ncAAs: BCN-Lys, TCO*-Lys, and SCO-Lys (Figure 5;
structures shown in Figure S5). Cells transfected with
pEnv407TAG or pEnv(WT) and the amber suppression system
were grown in the presence or absence of the respective
ncAA. Cells labeled with Cy5 functionalized with H-tetrazine
(H-Tet-Cy5, Figure S5) for 10 min were lysed for analysis by
immunoblot (Figure 5A, top panel and Figure S6B) and in-gel
fluorescence (Figure 5A, bottom panel and Figure S6A). All three
ncAAs were incorporated with comparable efficiencies, as indi-
cated by similar band intensities for gp160/gp120 in immuno-
blots (Figure 5A). In-gel fluorescence analysis revealed that

Env407BCN Lys and Env407TCO Lys were labeled with com-
parable efficiencies, while Env407SCO Lys was significantly less
reactive toward H-Tet-Cy5 under our conditions, in line with
previous findings (Nikic
et al., 2014). Labeling was not observed
for the Env(WT) control (Figures 5A and S6).
For imaging experiments, live cells expressing Env407BCN Lys
were incubated with H-Tet-Cy5 for 10 min, briefly fixed, and sub-
jected to indirect immunostaining for gp120 on the plasma mem-
brane. As shown in Figure 5C, extracellular Env407BCN Lys was
detected by immunostaining, indicating successful suppression
of the amber stop codon. In the majority of Env407BCN Lys-ex-
pressing cells, gp120 immunostaining coincided with a clearly
detectable Cy5 signal at the plasma membrane (Figure 5C, mid-
dle panel), while cells not expressing detectable Env (Figure 5C,
top panel) or WT Env (Figure 5C, bottom panel) were consistently
found to be Cy5 negative. Of note, EnvBCN Lys-expressing cells
640 Cell Chemical Biology 24, 635645, May 18, 2017
Figure 4. HIV-1 Particles Carrying Engi-
neered EnvncAA Retain Single-Round Infec-
tivity on TZM-bl Cells
(A) HEK293T cells were co-transfected with
the proviral plasmid pNL4-3(Env-), the indicated
EnvTAG expression plasmids and peRF1(E55D)
together with ptRNApyl/pylRSAF or empty control
vector as indicated and grown in the presence
or absence of 250 mM BCN-Lys. At 40 hpt, virus
particles were concentrated from the tissue
culture supernatant by ultracentrifugation and
relative infectivity was analyzed by titration on
TZM-bl indicator cells. Values were normalized
to the amount of virus particles, as assessed by
measuring reverse transcriptase activity using a
qPCR-based assay (Pizzato et al., 2009) as
described in the STAR Methods. The graph
shows mean values and SD from three inde-
pendent experiments. Statistical significance
between mean values for WT Env samples was
assessed by a paired Students t test. p Values
for the comparison of samples 7-8, 9-8, and
10-8 were 0.0270 (*), 0.0573 (ns), and 0.1212
(ns), respectively.
also displayed distinct intracellular Cy5-positive punctae not
co-localizing with Env immunostaining signals (Figure 5C, middle
panel). Such punctae were not detected in H-Tet-Cy5-stained
samples of untransfected or Env(WT)-expressing cells grown
in the presence of ncAA (Figure 5C, bottom panel) analyzed
in parallel, indicating that they did not reflect non-specific
uptake of dye aggregates. Conceivably, these intracellular
Cy5-positive punctae correspond to click-labeled Env proteins
that underwent endocytosis during the 10 min labeling step
and thereby became inaccessible to the subsequent cell surface
immunostaining.
Live-Cell Imaging and Super-resolution Nanoscopy of
Click-Labeled Env Proteins at the Plasma Membrane
For live-cell microscopy, cells were transfected with pEnv407TAG
and the amber suppression system. A small amount of peGFP-c1
was co-transfected to mark transfected cells under live condi-
tions and visualize the cell boundary. Cells were labeled with
H-Tet-Cy5 and imaged by spinning disk confocal microscopy.
Snapshots of live cells recorded in the GFP and Cy5 channels
showed a distinct Cy5 signal at the plasma membrane, confirm-
ing that the labeling was suited for live-cell imaging (Figure 5B).
A previous FRAP study employing indirect immunostaining
revealed that Env molecules located at Gag assembly sites
were essentially immobile (Roy et al., 2013). In contrast, an Env
variant deficient in recruitment to viral assembly sites and virion
incorporation due to deletion of the CT (DCT) displayed a mobile
fraction of 38.5% in the absence of Gag and 27% in the vicin-
ity of assembly sites (Roy et al., 2013). The mobility of Env(WT)
not associated with Gag was not analyzed in this study, however.
Here, we click-labeled Env407BCN Lys on the cell surface using
H-Tet-Cy5 in order to determine the Env mobility in the absence
of Gag. Labeled Env was efficiently photo bleached (Figure 6A
and Movie S1) and signal recovery was monitored over time.

Env-Cy5 signal intensity in the bleached region recovered
partially within approximately 9 s. Intensities did not reach the
initial value, indicating the presence of a substantial immobile
fraction of Env molecules (Figures 6B and S7). Analyzing data
from five cells, we determined a mean mobile HIV-1 Env fraction
of 45% 11% (Figures 6B and S7), which is similar to the mo-
bile fraction reported by Roy et al. (2013) for EnvDCT in the
absence of Gag (38.5%).
Env clusters at the plasma membrane in the absence or pres-
ence of nascent HIV-1 Gag assembly sites were visualized by
STED nanoscopy. For this, live cells expressing Env407BCN Lys
were click labeled with the STED-compatible dye KK114 func-
tionalized with tetrazine (H-Tet-KK114; Sednev et al., 2013; refer
to Figure S5 for the structure of H-Tet-KK114). Subsequently,
cells were fixed and imaged by STED nanoscopy (Figure 7).
Images of labeled cells were recorded in confocal and STED
mode, focusing on a central plane (Figure 7A) or on the ventral
plasma membrane (Figure 7B). As shown in Figures 7A and
7B, STED nanoscopy allowed a clear visualization and spatial
resolution of distinct Env clusters at the plasma membrane.
Figure 5. Engineered HIV Env407ncAA Can
Be Click Labeled with H-Tet-Cy5 on the
Plasma Membrane
(A) HEK293T cells were co-transfected with
pEnv(WT) or pEnv407TAG, peRF1 (E55D) and
ptRNApyl/pylRSAF, and grown in the presence or
absence of 250 mM of the indicated ncAA. At 40
hpt, live cells were incubated with 2 mM H-Tet-Cy5
for 10 min at 37 C, lysed, and cell lysates were
analyzed by in-gel fluorescence as described in
the STAR Methods, as well as quantitative
immunoblotting using polyclonal agp120 anti-
serum. See Figure S6 for images of the complete
gel.
(B) Snapshots of live HEK293T cells after click
labeling of HIV-1 Env as described in (A). Here,
co-transfection with pEGFP-C1 was performed in
addition to mark transfected cells and visualize
cell boundaries.
(C) HEK293T cells were co-transfected with
ptRNApyl/pylRSAF and pEnv407TAG or pEnv(WT)
and grown in the presence or absence of 250 mM
BCN-Lys. At 40 hpt, cells were incubated with
2 mM H-Tet-Cy5 (yellow) for 10 min at 37 C. Sub-
sequently, cells were washed, fixed, and sub-
jected to indirect immunostaining using mono-
clonal agp120 antibody 2G12 and Alexa Fluor
488-coupled secondary antibody (magenta). Blue,
Hoechst staining. Images were recorded by spin-
ning disk confocal microscopy.
Scale bars in (B) and (C), 10 mm.
Next, the distribution of Env at nascent
viral budding sites was analyzed by
STED nanoscopy (Figure 7C). Based on
indirect Env immunostaining it was previ-
ously concluded that the presence of
the viral Gag protein alters the distribu-
tion of Env molecules at the plasma
membrane, from small, evenly distrib-
uted clusters of Env expressed alone to
distinctive accumulations at viral budding
sites, surrounding nascent Gag assem-
blies (Muranyi et al., 2013; Roy et al., 2013). Viral assembly sites
were visualized by co-expressing a mixture of untagged and
eGFP-tagged Gag polyprotein (Gag-eGFP) together with
EnvBCN Lys directly labeled with H-Tet-KK114. As shown in Fig-
ure 7C, diffraction-limited spots of Env-KK114 apparently co-
localizing with Gag. eGFP were resolved as characteristic ring-
shaped clusters localized at viral assembly sites by STED nano-
scopy, indicating that this pattern reflects an inherent property of
Env not induced by antibody staining.
DISCUSSION
Here, we established a genetic code expansion strategy for site-
specific fluorescent labeling of the HIV-1 Env glycoprotein at one
of three different positions. Key advantages of this approach are
minimal invasiveness and high versatility: only a single modified
residue is introduced, and the engineered protein can be labeled
using various synthetic dyes tailored to the imaging method of
choice. This renders the system particularly attractive for the la-
beling of viruses, which are very sensitive toward modification
Cell Chemical Biology 24, 635645, May 18, 2017 641

Figure 6. FRAP Analysis of Click-Labeled Env Mobility at the Plasma
Membrane
(A) HEK293T cells were co-transfected with pEnv407TAG, ptRNApyl/pylRSAF,
and peRF1 (E55D), and grown in the presence of 250 mM BCN-Lys. At 40 hpt,
cells were labeled with 2 mM H-Tet-Cy5 as described in the STAR Methods,
and live-cell spinning disk confocal microscopy imaging was performed. Initial
movie sequences were recorded for 3 s, followed by photobleaching at the
region indicated by the arrowhead; subsequently, fluorescence recovery was
recorded for 10 s. Scale bar: 10 mM.
(B) The graph shows mean and SD of fluorescence intensities recorded over
time before and after photobleaching from five different cells. Data on fluo-
rescence recovery were fitted to a single exponential association equation
(magenta curve). Individual datasets were fitted separately (see Figure S7), and
the average half-times and mobile fractions (Mobile Fr) were calculated from
exponential fits to the individual datasets.
due to small genomes, overlapping open reading frames, and
multifunctional proteins (Sakin et al., 2016).
A current limitation of the approach is that suppression is
incomplete in eukaryotic cells, even for optimized model sys-
tems (Plass et al., 2012 and Figure S1). While we efficiently
labeled and characterized HIV-1 Env molecules at the plasma
membrane, click-labeled Env on the viral surface was not
analyzed in the present study due to low amounts of Env incor-
poration per virion. An average of only 714 Env trimers are
detected on WT HIV-1NL4-3 particles (Chertova et al., 2002;
Chojnacki et al., 2012; Zhu et al., 2003, 2006) and, depending
on the amount of Env(WT) expressed, pseudotyped HIV-1NL4-3
preparations were reported to contain 20%80% of virions
lacking gp120 (DeSantis et al., 2016). Therefore, the several-
fold reduction in relative Env amounts per particle for the EnvncAA
variants observed in the bulk preparations (Figure 4C) is bound to
translate into a substantial proportion of particles carrying only
very few Env trimers, or none at all, consistent with reduced
levels of relative infectivity of the virus pool. Increasing the pro-
portion of EnvncAA-carrying particles will thus require ensuring
the presence of all components of the suppression/expression
642 Cell Chemical Biology 24, 635645, May 18, 2017
system in appropriate amounts in the majority of virus-producing
cells, and possibly an even higher efficiency of suppression.
The methodology of genetic code expansion is rapidly evolving,
and developments of, e.g., multi-cassette vectors combining
expression modules for tRNA, pylRS, and the protein of interest
(e.g., Cohen and Arbely, 2016), cell lines stably expressing com-
ponents of the suppression system (e.g., Elsa sser et al., 2016; Si
et al., 2016), and improved versions of pylRS (Nikic
et al., 2016),
can be expected to translate in significant enhancement of sup-
pression levels in the near future. This should then allow employ-
ing the system also for the analysis of Env mobility on the particle
surface, which appears to be crucial for the process of HIV-1
maturation (Chojnacki et al., 2012).
Experiments performed in this study demonstrated the suit-
ability of the click-labeled Env protein for live-cell imaging
and SRFM. Employing this approach allowed us to validate
previous findings with respect to the mobility and nanoscale or-
ganization of Env on the plasma membrane (Lehmann et al.,
2011; Muranyi et al., 2013; Roy et al., 2013), with an Env protein
close to the native state. In contrast to indirect immunolabeling
used in previous studies, our approach minimizes artifacts in
mobility measurements resulting from additional mass, since
only 1 kDa is contributed by BCN-Lys conjugated to Cy5
compared with 25150 kDa for indirect immunostaining.
Furthermore, detecting one fluorophore directly linked to a spe-
cific site on the protein of interest, rather than an unknown
number of fluorophores separated from the protein of interest
by 1020 nm, increases the effective precision of spatial local-
ization in nanoscopy. Using directly labeled Env and employing
STED nanoscopy instead of stochastic optical reconstruction
microscopy applied in previous studies (Lehmann et al., 2011;
Muranyi et al., 2013; Roy et al., 2013), we could confirm the
recruitment of Env clusters surrounding HIV-1 Gag assemblies
at the plasma membrane.
Availability of Env labeled with a synthetic fluorophore at a
defined position also opens new possibilities for investigating
stoichiometry, distribution, mobility, and molecular rearrange-
ments of HIV-1 Env by counting-by-photon statistics and single-
molecule imaging, Foersters resonance energy transfer, time
resolved nanoscopy, or fluorescence correlation techniques. An
additional advantage of the method is that the click-labeling reac-
tion is completed within a few minutes under live-cell conditions.
Recent development of silicon rhodamine (Lukinavic ius et al.,
2013) and other fluorogenic cell-permeable dyes (e.g., Wieczorek
et al., 2016) allow specific staining of intracellular proteins in live
cells for advanced imaging applications. Thus, selective labeling
of Env at the cell surface, combined with differential labeling of
the total intracellular pool, should be feasible using appropriate
dye combinations. Amber suppression/click labeling therefore
has the potential to reveal dynamics of Env internalization from
the plasma membrane as well as dynamic interactions of Env
with cellular proteins, and to elucidate Env trafficking to viral as-
sembly sites or to virological synapses.
Beyond that, the approach is amenable to other viral proteins
that cannot be functionally labeled with other methods. Muta-
genesis studies revealed a high degree of sensitivity toward
even minor modifications for many viral proteins investigated.
While the most notable example of genetic fragility reported is
the HIV-1 capsid protein, a high proportion of point mutations
Figure 7. Visualization of Click-Labeled Env Clusters at the Plasma Membrane and at HIV-1 Assembly Sites by STED Nanoscopy
(A and B) HEK293T cells were co-transfected with pEnv407TAG, ptRNApyl/pylRSAF, and peRF1 (E55D), and grown in the presence of 250 mM BCN-Lys. At 40 hpt,
cells were labeled with 2 mM H-Tet-KK114 and analyzed by confocal microscopy and STED nanoscopy as described in the STAR Methods. Note that all STED
images shown here were deconvolved and background subtracted. Micrographs show a central section (A) and the ventral plasma membrane (B) recorded in
confocal or STED mode, as indicated. Scale bars, 2 mm (overview images) and 500 nm (enlargements). Arrows in (A) and (B) indicate spots of visible resolution
enhancement.
(C) The experiment was performed as in (A and B), with the exception that two additional plasmids, pcDNA-Gag and pSynGag-eGFP, were co-transfected to
induce the formation of eGFP-labeled viral assembly sites. Images show confocal and STED micrographs recorded at the ventral membrane of HEK293T cells.
The enlargement highlights Env clusters detected at Gag assembly sites. Scale bars, 1 mm (overview images) and 500 nm (enlargement). Arrowheads define the
line on which intensity profiles were measured in (B and C).

in other viral proteins, e.g., HIV-1 protease, structural proteins SIGNIFICANCE

of other retroviruses, or influenza virus hemagglutinin and
neuraminidase, was likewise found to be deleterious for virus
replication (Rihn et al., 2013 and references therein). Advancing
the concept of site-specific bio-orthogonal labeling of viral pro-
teins from the proof-of-principle to the functional application
state thus opens new possibilities for virus imaging.
The envelope glycoproteins of HIV (HIV-1 Env) mediate
entry of the pathogen into a new host cell. Mobility and clus-
tering of these proteins at the cell membrane and on the viral
surface appear to be crucial for Env function. Microscopic
analysis of the mobility and nanoscale organization of Env

Cell Chemical Biology 24, 635645, May 18, 2017 643

molecules was hampered by the lack of a fluorescent, func-
tional Env derivative, limiting previous studies to indirect im-
munolabeling. Antibody or Fab binding, however, introduces
substantial additional molecular mass to the protein of inter-
est, which may affect dynamic properties and reduces the
accuracy of protein localization by super-resolution micro-
scopy. Here, we used genetic code expansion in mammalian
cells combined with click chemistry to establish a minimally
invasive, site-specific, and versatile fluorescent-labeling
strategy for HIV-1 Env. Applying this strategy allowed us to
measure Env mobility and to visualize Env clustering at virus
assembly sites using live-cell and super-resolution micro-
scopy. Our results using an Env derivative close to its natural
state validate findings based on immunolabeling. The versa-
tile tool generated here is amenable for further studies on
HIV-1 Env dynamics in live cells.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODELS AND SUBJECT DETAILS
B Cell Lines and Culture Conditions
d METHOD DETAILS
B Plasmids
B Transfections
B Quantitative Immunoblot
B Endoglycosidase H Digestion
B Amber Suppression and Click Labeling
B In-gel Fluorescence
B Immunofluorescence
B Flow Cytometry
B Virus Purification
B SG-PERT Assay
B Single Round Infectivity Assays
B Fluorescence Recovery after Photobleaching (FRAP)
B Stimulated Emission Depletion (STED) Nanoscopy
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information includes seven figures and one movie and can be
found with this article online at http://dx.doi.org/10.1016/j.chembiol.2017.
04.007.
AUTHOR CONTRIBUTIONS
Conceptualization, B.M., E.A.L., and H.G.K.; Resources, B.M., H.G.K., E.A.L.,
I.N., and V.L.; Investigation, V.S., J.H., M.A.O., and J.D.; Formal Analysis, V.S.
and J.H.; Visualization, V.S., J.H., and V.L.; Writing Initial Draft, V.S. and B.M.;
Writing Review & Editing, E.A.L., J.H., I.N., V.L., H.G.K., V.S., and B.M.; Su-
pervision, B.M. and V.L.; Funding Acquisition, B.M., E.A.L., and H.G.K.
ACKNOWLEDGMENTS
We sincerely thank Jason Chin (MRC Laboratory of Molecular Biology, Cam-
bridge, UK) for providing peRF1(E55D), Ke Peng (University of Heidelberg,
Germany) for plasmids pNL4-3(Env402TAG), pNL4-3(Env407TAG), and pNL4-
3(Env457TAG), and Vladimir Belov and the Facility for Synthetic Chemistry
644 Cell Chemical Biology 24, 635645, May 18, 2017
(MPI for Biophysical Chemistry, Gottingen, Germany) for providing H-Tet-
KK114. We gratefully acknowledge Holger Lorenz (ZMBH, Heidelberg, Ger-
many) for stimulating discussion and advice on FRAP. This work has been
funded by the Deutsche Forschungsgemeinschaft through the Sonderfor-
schungsbereich 1129, project 6 (B.M.), project 7 (E.A.L.), and project 5
(H.G.K.). I.N. acknowledges support by an EMBO Long-Term Fellowship
and the European Commission Seventh Framework Programme (FP7) through
Marie Curie Actions (FP7-PEOPLE-IEF). E.A.L. and I.N. hold a patent covering
non-canonical amino acids used in this work.
Received: December 21, 2016
Revised: February 12, 2017
Accepted: April 6, 2017
Published: April 27, 2017
REFERENCES
Adachi, A., Gendelman, H.E., Koenig, S., Folks, T., Willey, R., Rabson, A., and
Martin, M.A. (1986). Production of acquired immunodeficiency syndrome-
associated retrovirus in human and nonhuman cells transfected with an infec-
tious molecular clone. J. Virol. 59, 284291.
Borrmann, A., Milles, S., Plass, T., Dommerholt, J., Verkade, J.M.M., Wiessler,
M., Schultz, C., van Hest, J.C.M., van Delft, F.L., and Lemke, E.A. (2012).
Genetic encoding of a bicyclo[6.1.0]nonyne-charged amino acid enables
fast cellular protein imaging by metal-free ligation. Chembiochem 13,
20942099.
usslich, H.-G.,
Bozek, K., Eckhardt, M., Sierra, S., Anders, M., Kaiser, R., Kra
ller, B., and Lengauer, T. (2012). An expanded model of HIV cell entry
Mu
phenotype based on multi-parameter single-cell data. Retrovirology 9, 60.
Charneau, P., Alizon, M., and Clavel, F. (1992). A second origin of DNA plus-
strand synthesis is required for optimal human immunodeficiency virus repli-
cation. J. Virol. 66, 28142820.
Checkley, M.A., Luttge, B.G., and Freed, E.O. (2011). HIV-1 envelope glyco-
protein biosynthesis, trafficking, and incorporation. J. Mol. Biol. 410, 582608.
Chertova, E., Bess, J.W., Crise, B.J., Sowder, R.C., II, Schaden, T.M., Hilburn,
J.M., Hoxie, J.A., Benveniste, R.E., Lifson, J.D., Henderson, L.E., et al. (2002).
Envelope glycoprotein incorporation, not shedding of surface envelope glyco-
protein (gp120/SU), Is the primary determinant of SU content of purified human
immunodeficiency virus type 1 and simian immunodeficiency virus. J. Virol. 76,
53155325.
Chojnacki, J., Staudt, T., Glass, B., Bingen, P., Engelhardt, J., Anders, M.,
usslich, H.-G. (2012). Maturation-
ller, B., Hell, S.W., and Kra
Schneider, J., Mu
dependent HIV-1 surface protein redistribution revealed by fluorescence nano-
scopy. Science 338, 524528.
Cohen, S., and Arbely, E. (2016). Single-plasmid-based system for effi-
cient noncanonical amino acid mutagenesis in cultured mammalian cells.
Chembiochem 17, 10081011.
DeSantis, M.C., Kim, J.H., Song, H., Klasse, P.-J., and Cheng, W. (2016).
Quantitative correlation between infectivity and Gp120 density on HIV-1 vi-
rions revealed by optical trapping virometry. J. Biol. Chem. 291, 1308813097.
Dorfman, T., Mammano, F., Haseltine, W.A., and Gottlinger, H.G. (1994). Role
of the matrix protein in the virion association of the human immunodeficiency
virus type 1 envelope glycoprotein. J. Virol. 68, 16891696.
sser, S.J., Ernst, R.J., Walker, O.S., and Chin, J.W. (2016). Genetic code
Elsa
expansion in stable cell lines enables encoded chromatin modification. Nat.
Methods 13, 158164.
usslich, H.-G. (2005). Analysis of human immunodefi-
Gottwein, E., and Kra
ciency virus type 1 Gag ubiquitination. J. Virol. 79, 91349144.
Hanne, J., Zila, V., Heilemann, M., Mu usslich, H.-G. (2016).
ller, B., and Kra
Super-resolved insights into human immunodeficiency virus biology. FEBS
Lett. 590, 18581876.
Hermida-Matsumoto, L., and Resh, M.D. (2000). Localization of human immu-
nodeficiency virus type 1 Gag and Env at the plasma membrane by confocal
imaging. J. Virol. 74, 86708679.
Kelemen, R.E., Mukherjee, R., Cao, X., Erickson, S.B., Zheng, Y., and
Chatterjee, A. (2016). A precise chemical strategy to alter the receptor speci-
ficity of the adeno-associated virus. Angew. Chem. Int. Ed. 55, 1064510649.
Lampe, M., Briggs, J.A.G., Endress, T., Glass, B., Riegelsberger, S.,
usslich, H.-G., Lamb, D.C., Bra
Kra uchle, C., and Mu ller, B. (2007). Double-
labelled HIV-1 particles for study of virus-cell interaction. Virology 360, 92104.
Lang, K., and Chin, J.W. (2014). Cellular incorporation of unnatural amino acids
and bioorthogonal labeling of proteins. Chem. Rev. 114, 47644806.
Lehmann, M., Rocha, S., Mangeat, B., Blanchet, F., Uji-I, H., Hofkens, J., and
Piguet, V. (2011). Quantitative multicolor super-resolution microscopy reveals
tetherin HIV-1 interaction. PLoS Pathog. 7, e1002456.
Lifson, J.D., Reyes, G.R., McGrath, M.S., Stein, B.S., and Engleman, E.G.
(1986). AIDS retrovirus induced cytopathology: giant cell formation and
involvement of CD4 antigen. Science 232, 11231127.
Lin, S., Yan, H., Li, L., Yang, M., Peng, B., Chen, S., Li, W., and Chen, P.R.
(2013). Site-specific engineering of chemical functionalities on the surface of
live hepatitis D virus. Angew. Chem. Int. Ed. 52, 1397013974.
Lukinavicius, G., Umezawa, K., Olivier, N., Honigmann, A., Yang, G., Plass, T.,
Mueller, V., Reymond, L., Correa, I.R., Luo, Z.-G., et al. (2013). A near-infrared
fluorophore for live-cell super-resolution microscopy of cellular proteins. Nat.
Chem. 5, 132139.
Munro, J.B., Gorman, J., Ma, X., Zhou, Z., Arthos, J., Burton, D.R., Koff, W.C.,
Courter, J.R., Smith, A.B., Kwong, P.D., et al. (2014). Conformational dynamics
of single HIV-1 envelope trimers on the surface of native virions. Science 346,
759763.
Muranyi, W., Malkusch, S., Mu usslich, H.-G.
ller, B., Heilemann, M., and Kra
(2013). Super-resolution microscopy reveals specific recruitment of HIV-1 en-
velope proteins to viral assembly sites dependent on the envelope C-terminal
tail. PLoS Pathog. 9, e1003198.
Nakane, S., Iwamoto, A., and Matsuda, Z. (2015). The V4 and V5 variable loops
of HIV-1 envelope glycoprotein are tolerant to insertion of green fluorescent
protein and are useful targets for labeling. J. Biol. Chem. 290, 1527915291.
Nikic
, I., and Lemke, E.A. (2015). Genetic code expansion enabled site-spe-
cific dual-color protein labeling: superresolution microscopy and beyond.
Curr. Opin. Chem. Biol. 28, 164173.

, I., Plass, T., Schraidt, O., Szyman
Nikic
ski, J., Briggs, J.A.G., Schultz, C., and
Lemke, E.A. (2014). Minimal tags for rapid dual-color live-cell labeling and su-
per-resolution microscopy. Angew. Chem. Int. Ed. 53, 22452249.

, I., Estrada Girona, G., Kang, J.H., Paci, G., Mikhaleva, S., Koehler, C.,
Nikic
Shymanska, N.V., Ventura Santos, C., Spitz, D., and Lemke, E.A. (2016).
Debugging eukaryotic genetic code expansion for site-specific Click-PAINT
super-resolution microscopy. Angew. Chem. Int. Ed. 55, 1617216176.
Pantophlet, R., Wang, M., Aguilar-Sino, R.O., and Burton, D.R. (2009). The
human immunodeficiency virus type 1 envelope spike of primary viruses can
suppress antibody access to variable regions. J. Virol. 83, 16491659.
Pereira, C.F., Ellenberg, P.C., Jones, K.L., Fernandez, T.L., Smyth, R.P.,
Hawkes, D.J., Hijnen, M., Vivet-Boudou, V., Marquet, R., Johnson, I., et al.
(2011). Labeling of multiple HIV-1 proteins with the biarsenical-tetracysteine
system. PLoS One 6, e17016.
Phair, R.D., Gorski, S.A., and Misteli, T. (2004). Measurement of dynamic pro-
tein binding to chromatin in vivo, using photobleaching microscopy. Methods
Enzymol. 375, 393414.
Pizzato, M., Erlwein, O., Bonsall, D., Kaye, S., Muir, D., and McClure, M.O.
(2009). A one-step SYBR Green I-based product-enhanced reverse transcrip-
tase assay for the quantitation of retroviruses in cell culture supernatants.
J. Virol. Methods 156, 17.
Plass, T., Milles, S., Koehler, C., Schultz, C., and Lemke, E.A. (2011).
Genetically encoded copper-free click chemistry. Angew. Chem. Int. Ed. 50,
38783881.
Plass, T., Milles, S., Koehler, C., Szyman
ski, J., Mueller, R., Wiessler, M.,
Schultz, C., and Lemke, E.A. (2012). Amino acids for Diels-Alder reactions in
living cells. Angew. Chem. Int. Ed. 51, 41664170.
Rihn, S.J., Wilson, S.J., Loman, N.J., Alim, M., Bakker, S.E., Bhella, D., Gifford,
R.J., Rixon, F.J., and Bieniasz, P.D. (2013). Extreme genetic fragility of the
HIV-1 capsid. PLoS Pathog. 9, e1003461.
Roy, N.H., Chan, J., Lambele, M., and Thali, M. (2013). Clustering and mobility
of HIV-1 Env at viral assembly sites predict its propensity to induce cell-cell
fusion. J. Virol. 87, 75167525.
ller, B. (2016). Labeling of virus
Sakin, V., Paci, G., Lemke, E.A., and Mu
components for advanced, quantitative imaging analyses. FEBS Lett. 590,
18961914.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch,
T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an
open-source platform for biological-image analysis. Nat. Methods 9, 676682.
Schmied, W.H., Elsa sser, S.J., Uttamapinant, C., and Chin, J.W. (2014).
Efficient multisite unnatural amino acid incorporation in mammalian cells via
optimized pyrrolysyl tRNA synthetase/tRNA expression and engineered
eRF1. J. Am. Chem. Soc. 136, 1557715583.
Sednev, M.V., Wurm, C.A., Belov, V.N., and Hell, S.W. (2013). Carborhodol: a
new hybrid fluorophore obtained by combination of fluorescein and carbopyr-
onine dye cores. Bioconjug. Chem. 24, 690700.
Si, L., Xu, H., Zhou, X., Zhang, Z., Tian, Z., Wang, Y., Wu, Y., Zhang, B., Niu, Z.,
Zhang, C., et al. (2016). Generation of influenza A viruses as live but replication-
incompetent virus vaccines. Science 354, 11701173.
Tedbury, P.R., and Freed, E.O. (2014). The role of matrix in HIV-1 envelope
glycoprotein incorporation. Trends Microbiol. 22, 372378.
Tedbury, P.R., Ablan, S.D., and Freed, E.O. (2013). Global rescue of defects in
HIV-1 envelope glycoprotein incorporation: implications for matrix structure.
PLoS Pathog. 9, e1003739.
Wei, X., Decker, J.M., Liu, H., Zhang, Z., Arani, R.B., Kilby, J.M., Saag, M.S.,
Wu, X., Shaw, G.M., and Kappes, J.C. (2002). Emergence of resistant human
immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20)
monotherapy. Antimicrob. Agents Chemother. 46, 18961905.
Wieczorek, A., Werther, P., Euchner, J., and Wombacher, R. (2016). Green- to
far-red-emitting fluorogenic tetrazine probes synthetic access and no-wash
protein imaging inside living cells. Chem. Sci. 00, 15.
Wilen, C.B., Tilton, J.C., and Doms, R.W. (2012). HIV: cell binding and entry.
Cold Spring Harb Perspect. Med 2.
Yu, X., Yuan, X., Matsuda, Z., Lee, T.H., and Essex, M. (1992). The matrix pro-
tein of human immunodeficiency virus type 1 is required for incorporation of
viral envelope protein into mature virions. J. Virol. 66, 49664971.
Zheng, Y., Yu, F., Wu, Y., Si, L., Xu, H., Zhang, C., Xia, Q., Xiao, S., Wang, Q.,
He, Q., et al. (2015). Broadening the versatility of lentiviral vectors as a tool in
nucleic acid research via genetic code expansion. Nucleic Acids Res. 43, e73.
Zhong, P., Agosto, L.M., Munro, J.B., and Mothes, W. (2013). Cell-to-cell
transmission of viruses. Curr. Opin. Virol. 3, 4450.
Zhu, P., Chertova, E., Bess, J., Lifson, J.D., Arthur, L.O., Liu, J., Taylor, K.A.,
and Roux, K.H. (2003). Electron tomography analysis of envelope glycoprotein
trimers on HIV and simian immunodeficiency virus virions. Proc. Natl. Acad.
Sci. USA 100, 1581215817.
Zhu, P., Liu, J., Bess, J., Chertova, E., Lifson, J.D., Grise, H., Ofek, G.A., Taylor,
K.A., and Roux, K.H. (2006). Distribution and three-dimensional structure of
AIDS virus envelope spikes. Nature 441, 847852.
Cell Chemical Biology 24, 635645, May 18, 2017 645
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
rabbit anti-GFP, polyclonal in house n/a
sheep anti-HIV-1 CA, polyclonal in house n/a
rabbit anti-gp120, polyclonal Valerie Bosch, DKFZ Heidelberg n/a
human anti-Env monoclonal (2G12) Polymun Scientific. P/N AB002
IRDye 800CW donkey anti-sheep IgG LI-COR Biosciences no longer available (can be replaced by
Cat# 713-625-147 from Dianova)
IRDye 800CW donkey anti-rabbit IgG LI-COR Biosciences P/N 926-32213; RRID: AB_621848
IRDye 680 donkey anti-rabbit IgG LI-COR Biosciences P/N 926-68073; RRID: AB_621845
AlexaFluor488 goat anti-human IgG Thermo Fisher Scientific Cat# A-11013; RRID: AB_141360
AlexaFluor647 goat anti-human IgG Thermo Fisher Scientific Cat# A-21445; RRID: AB_141843
Chemicals, Peptides, and Recombinant Proteins
Dulbeccos modified Eagles medium (DMEM), ThermoFisher Scientific Cat# 10566-016
high Glucose, GlutaMaxTM-I
DMEM, high glucose, HEPES, no phenol red ThermoFisher Scientific Cat# 21063-029
Opti-MEM Reduced Serum Medium ThermoFisher Scientific Cat# 31985062
Fetal bovine serum (FBS) Biochrom Cat# S0115
Polyethylenimine (PEI) Sigma Aldrich Cat# 40872-7
FuGENE HD Promega Cat# E2311
Paraformaldehyde Carl Roth Cat# 0335.3
Odyssey Blocking Buffer (TBS) LI-COR Biosciences P/N 927-50000
Endoglycosidase H Promega Cat# V4871
Endo BCN-L-Lysine-HCO2H-salt SiChem Cat# sc-8014
Axial isomer of trans-Cyclooct-2-ene-L-Lysine SiChem Cat# sc-8008
(TCO*-Lys)
Strained cyclooctyne-lysine (SCO-Lys) SiChem Cat# sc-8000
H-Tet-KK114 (Sednev et al., 2013) N/A
Hoechst 33258 ThermoFisher Scientific Cat# H1398
Protease Inhibitor Cocktail Tablets, EDTA-free Roche Cat# 11 836 153 001
Bovine Collagen Solution, Type I, 3mg/mL Advanced Biomatrix Cat# 5005
RNA, MS2 Sigma-Aldrich Cat# 10165948001
Ribolock RNase inhibitor ThermoFisher Scientific Cat# EO 0381
GoTaq Hotstart polymerase Promega Cat# M5005
dNTP set 100mM solution ThermoFisher Scientific Cat# R0181
SYBR Green I Nucleic acid gel stain ThermoFisher Scientific Cat# S7563
Critical Commercial Assays
Steady-Glo Luciferase Assay System Promega Cat# E2520
Experimental Models: Cell Lines
HEK293T ATCC CRL-3216
HeLa P4 (Charneau et al., 1992) RRID: CVCL_1H21
HeLa TZM-bl NIH AIDS Repository Cat# 8129; RRID: CVCL_B478
Oligonucleotides
RT assay forward primer: This paper N/A
TCCTGCTCAACTTCCTGTCGAG
RT assay reverse primer: This paper N/A
CACAGGTCAAACCTCCTAGGAATG
(Continued on next page)

e1 Cell Chemical Biology 24, 635645.e1e5, May 18, 2017

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Recombinant DNA
pCI-NLS-mCherry-GFPY39TAG (Plass et al., 2011) N/A
pCMV-Pyl Y306A, Y384F/tRNA (Plass et al., 2011) N/A
peRF1-E55D-pcDNA5 (Schmied et al., 2014) N/A
pcDNA3.1Gag usslich, 2005)
(Gottwein and Kra N/A
pGag.eGFP (Hermida-Matsumoto and N/A
Resh, 2000)
pNLC4-3(Env-) (Bozek et al., 2012) N/A
pCHIV (Lampe et al., 2007) N/A
pCHIVDEnv (Bozek et al., 2012) N/A
pCAGGS.Env(NL4-3) = pEnv(wt) (Bozek et al., 2012) N/A
pCAGGS.Env402TAG(NL4-3) This paper N/A
pCAGGS.Env407TAG(NL4-3) This paper N/A
pCAGGS.Env457TAG(NL4-3) This paper N/A
Software and Algorithms
GraphPad Prism Version 5.02 GraphPad Software Inc RRID: SCR_002798
Fiji (Schindelin et al., 2012) https://fiji.sc/; RRID: SCR_002285
Image StudioTM Lite Version 5.0 LI-COR Biosciences https://www.licor.com/bio/products/
software/image_studio_lite/; RRID: SCR_014211
FloJo FloJo, LCC vX.07 version 10; RRID: SCR_008520
ImageJ NIH https://imagej.nih.gov/ij/; RRID: SCR_003070
Imspector Abberior Instruments https://imspector.abberiorinstruments.
com/index.html

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fullfilled by the Lead Contact, Barbara
Muller (barbara.mueller@med.uni-heidelberg.de). Please note that plasmid peRF1 (E55D) was obtained through an MTA from J. Chin,
LMB Cambrigde, UK, a limited amount of polyclonal antiserum against gp120 was generously provided by the late V. Bosch (DKFZ,
Heidelberg, Germany), and H-Tet-KK114 was kindly shared by V. Belov (MPI Gottingen, Germany). Therefore, those reagents are not
available for distribution to others.

EXPERIMENTAL MODELS AND SUBJECT DETAILS

Cell Lines and Culture Conditions

HEK293T cells (human embryonic kidney), HeLa-P4 (a derivative of HeLa human cervix epithelial cells expressing CD4 and CXCR4;
(Wei et al., 2002), as well as HeLa cell derived TZM-bl indicator cells (Charneau et al., 1992) were cultured at 37 C and in a humidified
5% CO2 atmosphere in high glucose Dulbeccos modified Eagles medium-GlutaMaxTM-I (DMEM, ThermoFisher Scientific) supple-
mented with 10% (v/v) fetal bovine serum (FBS) and 50 mM HEPES, pH 7.4. Cells kept in culture were used for experiments only
between passages 3 and 20. Cell lines were not authenticated for the purpose of this study.

METHOD DETAILS

Plasmids
Env expression constructs generated for this study were prepared by standard molecular biology techniques. Plasmids pEnv402TAG,
pEnv407TAG and pEnv457TAG were generated by exchanging an MfeI/Bsu36I restriction fragment from proviral plasmids pNL4-
3(Env402TAG), pNL4-3(Env407TAG) or pNL4-3(Env457TAG) (derivatives of the HIV-1 proviral plasmid pNL4-3 (Adachi et al., 1986)
carrying a TAG insertion following the indicated codon in env, as outlined in Figure 1A; all kindly provided by Ke Peng, University
of Heidelberg, Germany), respectively, for the corresponding MfeI/Bsu36I fragment of plasmid pEnv(wt). The presence of mutations
was verified by DNA sequencing (GATC Biotech). All other plasmids were described previously (see Key Resources Table).

Cell Chemical Biology 24, 635645.e1e5, May 18, 2017 e2

Transfections
Transient transfections were carried out with polyethylenimine (PEI) using standard procedures or FuGENE HD reagent according to
the manufacturers instructions. Briefly, HEK293T cells (3.5 x 105/well) or HeLa P4 cells (2.0 x 105/well) were seeded the day before
transfection in 6-well plates in 2 mL complete growth medium. For PEI transfections, a stock solution of 100 mg/mL PEI in H2O was
prepared and stored in aliquots at -20 C. For use in trasfections, this stock solution was further diluted 1:100 to yield 1 mg PEI/ml in
H2O. For transfections, this solution was mixed at a ratio of 3mL/mg with DNA in DMEM without FBS and incubated for 30 min at room
temperature (RT). FuGENE HD was mixed with DNA at a ratio of 3 mL/mg in Opti-MEM reduced serum medium and incubated for
10 min at RT. The mixture was then added to the tissue culture medium and cells were further incubated at 37 C. No medium ex-
change was performed after transfection.

Quantitative Immunoblot
Samples were resolved by SDS-PAGE in Laemmli buffer using separation gels with a low degree of crosslinking (acrylamide:
bisacrylamide 200:1) and total acrylamide concentrations (w/v) of 15% for Env detection, or 17.5% for Gag detection. Proteins
were transferred to a nitrocellulose membrane by semi-dry blotting (0.75 mA/cm2 for 1 h) and membranes were blocked with
5% (w/v) skimmed milk powder in phosphate buffered saline (PBS) for 30 min. Membranes were incubated with primary antibodies
diluted in 5% milk solution overnight at 4 C, followed by incubation with the indicated fluorophore-coupled secondary antibodies
(diluted 1:10.000 in LI-COR blocking buffer) for 45 min at RT. Detection and quantitation of bound antibodies was performed using
a LI-COR Odyssey infrared scanner and ImageStudio LITE software (LI-COR Biosciences).

Endoglycosidase H Digestion
HEK293T cells were seeded in 6-well plates and transfected with plasmids encoding either wild type NL4-3 Env or Env407TAG
together with ptRNApyl/pylRSAF and peRF1 (E55D) at a molar ratio of 2:1:1. At 40h post-transfection (h.p.t.), cells were washed
once with PBS and then lysed with 250 mL/well denaturing lysis buffer (20 mM Tris-HCI, pH 7.0, supplemented with 50 mM NaCI,
0.5% (w/v) SDS, 1 mM dithiothreitol, 5mM EDTA and protease inhibitor cocktail) on ice for 10 min, followed by ultracentrifugation
for 30 min at 20,000 rpm using a Beckman TLA-55 fixed-angle rotor at 4 C. 20 ml of cleared lysates were incubated with 500 units
of Endoglycosidase H for 4h at 37 C and subsequently analyzed by immunoblotting using polyclonal agp120 antiserum.

Amber Suppression and Click Labeling

Cells co-tranfected with the indicated Env expression plasmid, ptRNApyl/pylRSAF and peRF1 (E55D) at a molar ratio of 2:1:1 were
grown in DMEM supplemented with 50mM HEPES, pH 7.4, 10% (v/v) FBS and 250 mM of the indicated ncAA. For the experiments
shown here, we used either endo Bicyclo[6.1.0]nonyne-L-Lysine (BCN-Lys), the axial isomer of trans-Cyclooct-2-ene-L-Lysine
(TCO*-Lys), or strained cyclooctyne-lysine (SCO-Lys) at a final concentration of 250 mM. 100 mM stock solutions of ncAAs were pre-
pared in 0.2M NaOH and 15 % DMSO and diluted 1:4 in 1 M HEPES directly before use. At 40 h.p.t. labeling was performed by
exchanging the tissue culture medium with medium supplemented with 2 mM 3-(p-Benzylamino)-1,2,4,5-tetrazine-Cy5 (H-Tet-
Cy5) or H-Tet-KK114 and incubating the cells for 10 min at 37 C. Cells were then washed gently with PBS three times. Subsequently,
samples were either fixed for 3 min with 4 % (w/v) paraformaldehyde (PFA) in PBS at room temperature and analyzed by immuno-
fluorescence, or incubated in DMEM supplemented with 4 mM L-Glutamine, 10 % FBS and 25 mM HEPES, lacking phenol red for
live-cell applications.

In-gel Fluorescence
HEK293T cells were seeded on 12-well plates at a density of 2x105 cells/well in 1 mL DMEM supplemented with 10% FBS and 50 mM
HEPES, pH 7.4. On the following day, cells were co-tranfected with 1 mg/well of a mixture of the indicated Env expression plasmid,
ptRNApyl/pylRSAF and peRF1 (E55D) at a molar ratio of 2:1:1. 250 mM of BCN-Lys was added to the tissue culture medium before
transfection. At 40 h.p.t., cells were washed once with PBS and then labeled with 2 mM H-Tet-Cy5 for 10 min at 37 C on the plate.
Subsequently, cells were washed with PBS three times and lysed with 150 mL of 3x Laemmli Buffer followed by heating at 95 C for
10 min. Samples were separated by SDS-PAGE using 15% polyacrylamide gels. Gels were scanned using a Typhoon FLA 7000 scan-
ner (633 laser line; PMT:550) to detect fluorescent bands.

Immunofluorescence
4-well LabTEK chamber slides were coated with 800 mL of diluted sterile collagen stock solution (1:1000 in 0.05M HCI) for 1 h at RT.
The collagen solution was discarded, chamber slides were washed three times with PBS, and HEK293T cells (1.2 x 105/well) were
seeded into the wells in 1 mL growth medium and incubated at 37 C over night. Transfections (0.8 mg DNA/well) were performed with
PEI reagent as described above. At 40 h.p.t., cells were carefully washed with PBS and fixed with 4% (w/v) PFA in PBS for 3 min at RT.
Where indicated, cells were permeabilized with 0.2 % (v/v) Triton X-100 for 5min at RT. Blocking was performed with 2 % (w/v) bovine
serum albumin (BSA) in PBS for 30 min. Primary agp120 antibody 2G12 diluted in BSA blocking buffer (1:1000) was applied to each
well for 2 h in a humidified chamber at RT, followed by incubation with a mixture of fluorophore-coupled secondary antibody (1:2000)
and Hoechst staining solution (1mg/ml) for 30 min. Cells were kept in PBS and imaged by an UltraVIEW VoX SDC microscope (Perkin
Elmer) using a 60X oil-immersion objective (NA 1.49; Perkin Elmer). For syncytia quantification, images were recorded using an
Olympus IX81Widefield fluorescence microscope with 40X oil-immersion objective (Olympus, LUCPlan Fi, NA 0.6).

e3 Cell Chemical Biology 24, 635645.e1e5, May 18, 2017

Flow Cytometry
HEK293T cells were seeded in 6-well plates and transfected with ptRNApyl/pylRSAF and peRF1 (E55D) together with pCDNA3.1,
pEnv(WT) or pEnvTAG407, respectively using PEI. Mock-transfected cell were prepared in parallel as a control for live-cell gating.
Samples were grown in the presence or absence of 250 mM BCN-Lys. At 40 h.p.t. tissue culture medium was removed, cells
were gently washed twice with PBS and then rinsed from the plate using 1 ml PBS/well. Cell suspensions were transferred into
1.5 ml eppendorf tubes and centrifuged briefly (5 min, 5000 rpm at 4 C). Cell pellets were resuspended in 100 ml 3% PFA/tube
and incubated for 10 min at RT. 1 ml PBS/tube was added and samples were centrifuged again (5 min, 3000 rpm). Cell pellets
were resuspended in blocking buffer (2% BSA in PBS) and incubated for 30 min at RT. Subsequently, 100 ml of primary antibody
(polyclonal rabbit agp120, 1:250 in blocking buffer) was added and incubation was continued for 1 h at 4 C. Cells were then subjected
to 3 cycles of washing with 1 ml PBS, followed by centrifugation (5 min, 3000 rpm). Staining with secondary antibody (arabbit Alexa-
Fluor488, 1:1000 in blocking buffer) was performed for 60 min at 4 C, followed again by three washing steps with 1 ml PBS. Finally,
cells were resuspended in 300 mL PBS. Analysis was performed using a FACSVerseTM cell sorter (BD Biosciences); 10.000 cells were
counted for each sample. Unstained mock-transfected control cells were used to set the live cell gate based on forward and side
scatter. Settings in the FITC-A channel to gate for Alexa488 positive cells were based on cells transfected with pcDNA3.1 grown
in the presence of BCN-Lys and stained with both primary and secondary antibody. Data analysis was perfomed using FlowJo soft-
ware (FlowJo, LLC).

Virus Purification
HEK293T cells grown in 6-well plates to 50-60% confluency were co-transfected with pNL4-3(Env-), pEnv(WT) or pEnvTAG mutants
as indicated, ptRNApyl/pylRSAF and peRF1 (E55D) at a molar ratio of 3.5:1:1:1 using PEI. At 40 h.p.t. tissue culture supernatants were
harvested, cleared by centrifugation at low speed (3000 rpm) for 5 min and 1300 ml of supernatant was layered carefully on a 100 ml
sucrose cushion (20% w/v in PBS). After ultracentrifugation for 45 min at 44,000 rpm using a Beckman TLA-100 fixed-angle rotor, the
supernatants were carefully removed and particles were gently resuspended in 60 mL PBS on ice for downstream applications.

SG-PERT Assay
Sybr Green-based product enhanced reverse transcriptase (SG-PERT) assays were based on a previously published protocol (Piz-
zato et al., 2009). Briefly, 1 mL of purified infectious HIV-1 particles were mixed with 4 mL PBS and lysed with 5 mL of 2X lysis buffer
(50mM KCI, 100mM Tris-HCI pH 7.4, 40% glycerol, 0.25% Triton X-100) supplemented with 2 Units of RNase inhibitor in a total
volume of 10 mL for 10 min at RT. Lysed particles were serially diluted (1:1000) in dilution buffer (5 mM (NH4)SO4, 20 mM KCI,
20 mM Tris-HCI pH 8.0). 10 mL of diluted viral lysate was mixed with 10mL of 2X SG-PERT reaction mixture (1x dilution buffer,
10 mM MgCI2, 2x BSA, 400 mM dATP, 400 mM, dTTP, 400 mM dGTP, 400 mM dCTP, 1 pmol RT forward primer, 1 pmol RT reverse
primer, 8 ng MS2 RNA, SYBR Green 1:10.000 diluted) supplemented with 0.5 Units of GoTaq Hotstart polymerase. RT-PCR reactions
were performed using a BioRad CFX96 real-time PCR cycler using the following conditions: 42 C 20 min - 95 C 2 min - 40 cycles of
95 C 5 s; 60 C 5 s; 72 C 15 s - 80 C 7 s. Tissue culture supernatants from HEK293T cells transfected with pCHIV (5,088 x 109 pUnits
RT/mL) were used to generate standard curves.

Single Round Infectivity Assays

Infectivity assays were carried out using the Steady-Glo luciferase assay system according to the manufacturers instructions.
Briefly, TZM-bl indicator cells seeded in 96-well plates (104 cells/well) were incubated with serial twofold dilutions of sucrose-pelleted
virus particles in growth medium. At 48 h post infection, the medium was removed and the cells were incubated with 100 mL of
Steady-Glo luciferase assay reagent diluted in growth medium (1:1) for 10 min at RT. Subsequently, 80 mL of the cell lysate was trans-
ferred to 96-well plates compatible with the measurement of luciferase activity. Relative light units (RLU) were plotted against the
volume of virus stock added and regression analysis from the linear range was employed to determine sample infectivity (RLU/ml
sample). Relative infectivity was determined by normalization of infectivity to either CA amounts determined by quantitative immu-
noblotting, using recombinant purified CA protein as a standard, or to reverse transcriptase activity determined by the SG-PERT
assay described above, as indicated.

Fluorescence Recovery after Photobleaching (FRAP)

FRAP was performed on the 37 C stage of an UltraVIEW VoX SDC microscope (Perkin Elmer) equipped with a 60X oil-immersion
objective (NA 1.49) using the 561 nm laser line. For quantitative experiments, pre-bleach images were captured for 3 sec with
maximum speed (50 ms/frame). A circular area of 2 mm2 was photobleached at full laser power (561 nm laser, 50 mW, 100 % power)
using an UltraVIEW PK device. Recovery of fluorescence was captured for 10 s with maximum speed at low laser power (8 %, 640 nm
line, 40 mW). Before estimating the recovery parameters the background was substracted from the fluorescence intensity data fol-
lowed by the bleaching correction (Double normalisation method (Phair et al., 2004) using ImageJ (NIH, https://imagej.nih.gov/ij/). A
bleaching curve was determined from a different area on the plasma membrane of the same cell and used for normalization of values
determined in the recovering area. Fluorescence intensity over time was plotted using GraphPad Prism software, and the data were
fitted to a one-phase exponential association function to calculate recovery half-times and immobile fractions.

Cell Chemical Biology 24, 635645.e1e5, May 18, 2017 e4

Stimulated Emission Depletion (STED) Nanoscopy
STED imaging was performed on fixed samples at a gated l=775 nm STED system containing an easy 3D optics module (Abberior
Instruments) and the l=640 nm excitation laser line. Images of Env labelled with H-Tet-KK114 were acquired with a dwell time of 40 ms
for 2 line accumulations and a pixel size of 20 nm. STED laser power was set to 35 % of the maximal power of 1,250 mW. About 30 to
60 counts were detected per STED image. Additional confocal images of Gag.eGFP excited at l=488 nm were acquired. Deconvo-
lution of STED images was performed with a Lorentzian function (full width half maximum 50 nm) via the linear deconvolution tool
implemented in Imspector (Abberior Instruments). Intensity line-profiles were drawn in Imspector (Abberior Instruments) and normal-
ized to the maximum intensity value for the corresponding STED and confocal images at the same position.

QUANTIFICATION AND STATISTICAL ANALYSIS

Data fitting and statistical analyses were performed using GraphPad Prism version 5.0. Wherever statistical significance of the com-
parision of two samples was calculated, DAgostino and Pearson omnibus normality test was applied by using GraphPad software in
order to check whether the values come from a Gaussian distribution or not. In cases where Gaussian distribution was not the case, a
non-parametric test such as Mann-Whitney U-test was applied. For samples with Gaussian distribution, a paired Students t-test was
applied for comparison. Statistical values (n and statistical significance), as well as statistical tests used are reported in Figure
Legends. Statistical significance (*) was defined as p<0.05.

e5 Cell Chemical Biology 24, 635645.e1e5, May 18, 2017