Journal of Dermatological Science (2003) 33, 195
/198
www.elsevier.com/locate/jdermsci
LETTER TO THE EDITOR
Pro-inflammatory cytokine interleukin-1a is
downregulated during anagen phase of hair
cycle in vivo
Hair follicles exhibit an intrinsic hair cycle,
alternating between periods of anagen, catagen,
and telogen, though the regulatory mechanisms
involved remain unclear. C3H/HeN mice provide a
good model system for studying the hair cycle in
vivo, and an inflammatory or immunity event is
thought to be involved in this process. In this study,
we attempted to determine whether pro-inflam-
matory cytokines such as interleukin (IL)-1a, IL-1b,
and tumor necrosis factor-a (TNF-a), Th1/Th2
cytokines such as interferon-g (IFN-g), IL-2, IL-4,
and IL-5, are associated with hair cycle in vivo.
Male C3H/HeN mice aged 20 days (young group)
or 7 weeks (aged group) were used in this study.
After the pre-feeding period, the dorsal areas (2
cm in width and 4 cm in length) of mice in the aged
group were clipped with a clipper and treated with
hair remover [1]. The dorsal skin areas were then
removed and trimmed along the edge of the
treated area. For study of the normal hair cycle,
dorsal skin samples from the young group were
dissected and used for assays. Dissected dorsal skin
samples for RT-PCR assay were immediately homo-
genized and extracted in a lysis buffer. For ELISA
assay, the dorsal skins were homogenized and
centrifuged. The cytokine content in each super-
natant was assessed with an ELISA kit (BIOTRAK,
mouse ELISA system, Amersham Pharmacia Bio-
tech, Buckinghamshire, UK).
Anagen was induced by depilation treatment
during the second telogen phase in male C3H/NeH
mice, and the cytokine changes were examined
until the next telogen. The anagen, hair re-growth,
phase in the aged group occurred on 11 days after
depilation, and was completed by day 18. Transi-
tional catagen was observed on day 22 and then
telogen on day 29. Meanwhile, the hair cycle phase
was in telogen if not treated by depilation.
Fluctuations in the expression of IL-1a, IL-1b,
TNF-a, IFN-g, IL-2, IL-4 and IL-5 were analyzed in
anagen-induced C3H/HeN mice by RT-PCR. We
found that the fluctuation of the IL-1a mRNA
0923-1811/03/$30.00 – 2003 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jdermsci.2003.08.001
expression, but not others, in depilated mice was
observed, compared with non-treated control mice
(Fig. 1a). The protein content of IL-1a in depilated
mice was significantly decreased just after anagen-
induction and then returned to the level of non-
treated control mice during telogen (Fig. 1b).
Changes of pro-inflammatory cytokines IL-1a, IL-
1b, and TNF-a were examined during the second
hair cycle in C3H/He mice without performing
anagen-induction. The telogen period ended 24
days after birth, and the second anagen period was
extended to day 35, while the second catagen
phase began day 39 and the second telogen phase
started on day 45. The IL-1a mRNA expression was
only significantly increased from the late anagen to
catagen phase (Fig. 2a). Moreover, the IL-1a
protein content was decreased at the start of
anagen phase and then regulated at a lower level
during the anagen period (Fig. 2b). After the
anagen period, it returned to the normal level.
In the anagen-induced model, the content of
histamine and activity level of its synthesizing
enzyme, histidine decarboxylase, were increased
just after anagen induction by depilation and
returned to a normal level at the beginning of
anagen, as we previously reported [1,2]. Since
histamine is one of the chemical mediators that
are mainly derived from the mast cells and
basophilic cells, an inflammatory or immunity
event is thought to be involved in the regulation
of hair growth as others have suggested [3
/5]. In
the present study, the mRNA expression and
protein content of cytokines, which included an-
drogen-inducible IL-1a and IL-1b, as well as TNF-a,
were examined during the hair cycle. Among them,
only IL-1a was significantly decreased just after
depilation treatment, as compared with non-trea-
ted control mice, and then returned to a normal
level at the telogen phase, which was interestingly
in contrast to that of histamine and its synthesizing
enzyme. This result is similar to another study with
C57BL/6 mice, except for IL-1b [6]. Further,
intradermal injections of pro-inflammatory cyto-
kines into the dorsal skin of mice have been shown
to induce apoptosis of hair bulbar keratinocytes
[7]. Together, these results suggest that IL-1a may
be a candidate as regulatory factor of anagen
/
catagen transformation.
196 Letter to the Editor

Fig. 1 mRNA expression and protein content level of IL-1a in the anagen-induced dorsal skin. The samples were
extracted from the skin 1, 8, 11, 15, 22 and 29 days after anagen induction (Clipped) and compared with the non-
treated control skin from the same age mice (Control). (A) mRNA expression of IL-1a was assayed using a RT-PCR
method. The primers used in this study were as follows: b-actin (product size 349 bp), sense primer
TGGAATCCTGTGGCATCCATGAAAC, antisense primer TAAAACGCAGCTCAGTAACAGTCCG; IL-1a (309 bp ), sense primer
CTCTAGAGCACCATGCTACAGAC, antisense primer TGGAATCCAGGGGAAACACTG. The PCR amplification was used for 25
cycles (1 min of denaturation at 94 8C, 2 min of annealing at 60 8C, and 3 min of extension at 72 8C). Aliquots of the PCR
product were then run on 1.5% agarose gels and visualized by ethidium bromide staining before analysis. The intensity
of cytokine mRNA expression was estimated by calculating the relative density of cytokine PCR bands against b-actin in
the same sample. Upper lane, relative intensity; lower lane, typical expression pattern. (B) Protein content of IL-1a
was assayed using an ELISA method. Marked area in the diagram shows the anagen phase. Results are presented as
means9/S.E.M. for three animals assayed individually. * P B/0.01 compared with control.
Letter to the Editor 197

Fig. 2 mRNA expression and protein content level of IL-1a during second hair cycle. The samples were extracted from
the skin 20, 24, 28, 31, 35, 39 and 45 days after birth and used for assays. (A) mRNA expression of IL-1a was assayed
using a RT-PCR method. The conditions for RT-PCR reaction were the same as shown in Fig. 1. Upper lane, relative
intensity; lower lane, typical expression pattern. (B) Protein content of IL-1a was assayed using an ELISA method.
Marked area in the diagram shows the anagen phase. Results are presented as means9/S.E.M. for three animals assayed
individually. * P B/0.01, ** P B/0.05 compared with 20 days after birth.

As a new approach, the second hair cycle of C3H
mice was studied to investigate the change of IL-1a
during the hair cycle without anagen-induction by
depilation. In this model, the content of IL-1a was
regulated at a lower level only during anagen, and
then returned to a normal level at telogen, while
the IL-1a mRNA expression was significantly in-
creased from the late anagen to catagen phase. It
means that an increase of the IL-1a mRNA expres-
sion preceded that of IL-1a protein production.
This suggests that IL-1a mRNA expression may be
regulated so that the IL-1a content is
maintained at a preferable level during the hair
cycle.
It has been shown that IL-1a was present at
multiple sites within the skin, including hair follicle
[8], and inhibited hair follicle growth in vitro [3,4].
Moreover, an over-expression of IL-1a in transgenic
198 Letter to the Editor

mice exhibited phenotype of hair loss in vivo as [6] Hoffmann R, Happle R, Paus R. Elements of the interleukin-
1 signaling system show hair cycle-dependent gene expres-
Groves et al. [9] reported. Since IL-1a was regu-
sion in murine skin. Eur J Dermatol 1998;8:475
/7.
lated at a lower level during the growing period of [7] Ruckert R, Lindner G, Bulfone-Paus S, Paus R. High-dose
hair cycle (anagen) and at a higher level in the proinflammatory cytokines induces apoptosis of hair bulb
relatively inactive period (from catagen to telo- keratinocytes in vivo. Br J Dermatol 2000;143:1036
/9.
gen), it may act as an inhibitory factor during hair [8] Boehm KD, Yun JK, Strohl KP, Elmets CA. Messenger RNAs
for the multifunctional cytokines interleukin-1a, interleu-
growth and its cycle in vivo as in case of TGF-b1
kin-1b and tumour necrosis factor-a are present in adnexal
[10]. tissues and in dermis of normal human skin. Exp Dermatol
In conclusion, IL-1a, a pro-inflammatory cyto- 1995;4:335
/41.
kine, was found downregulated during the anagen [9] Groves RW, Mizutani H, Kieffer JD, Kupper TS. Inflamma-
phase of the hair cycle in vivo, but not IL-1b, TNF- tory skin disease in transgenic mice that express high levels
of interleukin-1a in basal epidermis. Proc Natl Acad Sci USA
a, IFN-g, IL-2, IL-4 nor IL-5. Our results suggest that
1995;92:11874
/8.
IL-1a may be involved as a negative regulatory [10] Liu X, Alexander V, Vijayachandra K, Bhogte E, Diamond I,
factor of hair growth and its cycle, not only in Glick A. Conditional epidermal expression of TGFb1 blocks
anagen
/catagen transformation, but also in ana- neonatal lethality but causes a reversible hyperplasia and
gen induction. Therefore, IL-1a may play an alopecia. Proc Natl Acad Sci USA 2001;98:9134
/44.
important role in hair diseases. The elucidation of
IL-1a as an inhibitory factor during the hair cycle Kazuto Hamadaa,*, Shunsuke Yamazakib,
should enable effective treatment for hair diseases Keiko Suzukib Sachiyo Hirotsua, Hideyo Uchiwaa
a
such as alopecia areata and androgenetic alopecia. Basic Research Laboratory,
Kanebo Ltd., 28-5,
References Kotobuki-3,
Odawara,
[1] Hamada K, Suzuki K. Evaluation of biochemical indices as a Kanagawa 250-0002,
hair cycle marker in C3H mice. Exp Anim 1996;45:251
/6. Japan
[2] Hamada K, Suzuki K. Study on histamine related enzyme
activities during murine hair cycle. Exp Anim 1997;46:319
/
22. b
Cosmetics Laboratory,
[3] Harmon CS, Nevins TD. IL-1a inhibits human hair growth Kanebo Ltd., 28-5,
and hair fiber production in whole-organ cultures. Lympho-
kine Cytokine Res 1993;12:197
/203. Kotobuki-3,
[4] Philpott MP, Sanders DA, Bowen J, Kealey T. Effects of Odawara,
interleukins, colony-stimulating factor and tumour necrosis Kanagawa 250-0002,
factor on human hair follicle growth in vitro: a possible role Japan
for interleukin-1 and tumour necrosis factor-a in alopecia
areata. Br J Dermatol 1996;135:942
/8.
[5] Mahe YF, Buan B, Billoni N, Loussouarn G, Michelet JF,
*Corresponding author.
Gautier B, Bernard BA. Pro-inflammatory cytokine cascade E-mail address:
in human plucked hair. Skin Pharmacol 1996;9:366
/75. kazuhamada@oda.cos.kanebo.co.jp