. THE ADLEMAN EXPERIMENT the advantage of DNA.
It’s small and there are
There is no better way to understand how something
works than by going through an example step by step.
So let’s solve our own directed Hamiltonian Path
problem, using the DNA methods demonstrated by
Adleman. The concepts are the same but the example
has been simplified to make it easier to follow and
present.
Suppose that I live in LA, and need to visit four
cities:Dallas, Chicago, Miami, and NY, with NY
being my final destination. The airline I’m taking
has a specific set of connecting flights that restrict
which routes I can take (i.e. there is a flight from
L.A. to Chicago, but no flight from Miami to
Chicago). What should my itinerary be if I want to
visit each city only once?
It should take you only a moment to see that there is
only one route. Starting from L.A. you need to fly to
Chicago, Dallas, Miami and then to N.Y. Any other
choice of cities will force you to miss a destination, visit
a city twice, or not make it to N.Y. For this example you
obviously don’t need the help of a computer to find a
solution. For six, seven, or even eight cities, the problem
is still manageable. However, as the number of cities
increases, the problem quickly gets out of hand.
Assuming a random distribution of connecting routes,
the number of itineraries you need to check increases
exponentially. Pretty soon you will run out of pen and
paper listing all the possible routes, and it becomes a
problem for a computer...
...or perhaps DNA. The method Adleman used to solve
this problem is basically the shotgun approach
mentioned previously. He first generated all the possible
itineraries and then selected the correct itinerary. This is
combinatorial techniques that can quickly generate many
different data strings. Since the enzymes work on many
DNA molecules at once, the selection process is
massively parallel.Specifically, the method based on
Adleman’s experiment would be as follows:
• Generate all possible routes.
• Select itineraries that start with the proper city
and end with the final city.
• Select itineraries with the correct number of
cities.
• Select itineraries that contain each city only
once.
All of the above steps can be accomplished with
standard molecular biology techniques.
Part I: Generate all possible routes
Strategy: Encode city names in short DNA sequences.
Encode itineraries by connecting the city sequences for
which routes exist.
DNA can simply be treated as a string of data. For
example, each city can be represented by a “word” of six
bases:
Los Angeles GCTACG
Chicago CTAGTA
Dallas TCGTAC
Miami CTACGG
New York ATGCCG
The entire itinerary can be encoded by simply stringing
together these DNA sequences that represent specific
cities. For example, the route from
L.A -> Chicago -> Dallas -> Miami -> New York would
simply be
GCTACGCTAGTATCGTACCTACGGATGCCG, or
equivalently it could be represented in double stranded
form with its complement sequence.
So how do we generate this? Synthesizing short single
stranded DNA is now a routine process, so encoding the
city names is straightforward. The molecules can be
made by a machine called a DNA synthesizer or even
custom ordered from a third party. Itineraries can then
be produced from the city encodings by linking them
together in proper order. To accomplish this you can
take advantage of the fact that DNA hybridizes with its
complimentary sequence. For example, you can encode
the routes between cities by encoding the compliment of
the second half (last three letters) of the departure city
and the first half (first three letters) of the arrival city.
For example the route between Miami (CTACGG) and
NY (ATGCCG) can be made by taking the second half
of the coding for Miami (CGG) and the first half of the
coding for NY (ATG). This gives CGGATG. By taking
the complement of this you get, GCCTAC, which not
only uniquely represents the route from Miami to NY,
but will connect the DNA representing Miami and NY
by hybridizing itself to the second half of the code
representing Miami (...CGG) and the first half of the
code representing NY (ATG...). For example:
Random itineraries can be made by mixing city
encodings with the route encodings. Finally, the DNA
strands can be connected together by an enzyme called
ligase. What we are left with are strands of DNA
representing itineraries with a random number of cities
and random set of routes. For example:
We can be confident that we have all possible
combinations including the correct one by using an
excess of DNA encodings, say 10^13 copies of each city
and each route between cities. Remember DNA is a
highly compact data format, so numbers are on our side.
Part II: Select itineraries that start and end with the
correct cities
Strategy: Selectively copy and amplify only the section
of the DNA that starts with LA and ends with NY by
using the Polymerase Chain Reaction.
“After Part I, we now have a test tube full of various
lengths of DNA that encode possible routes between
cities. What we want are routes that start with LA and
end with NY. To accomplish this we can use a technique
called Polymerase Chain Reaction (PCR), .Polymerase
chain reaction (PCR), is a common method of creating
copies of specific fragments of DNA. PCR rapidly
amplifies a single DNA molecule into many billions of
molecules. PCR exploits the remarkable natural function
of the enzymes known as polymerases. These enzymes
are present in all living things, and their job is to copy
genetic material (and also proofread and correct the
copies). Sometimes referred to as “molecular
photocopying,” PCR can characterize, analyze, and
synthesize any specific piece of DNA or RNA. It works
even on extremely complicated mixtures, seeking out,
identifying, and duplicating a particular bit of genetic
material from blood, hair, or tissue specimens, from
microbes, animals, or plants, some of them many
thousands-or possibly even millions-of years old.
PCR requires a template molecule-the DNA or RNA you
want to copy-and two primer molecules to get the
copying process started. The primers are short chains of
the four different chemical components that make up
any strand of genetic material. These four components
are like bricks or building blocks that are used to
construct genetic molecules; in the lab they are called
nucleotides or bases.
DNA itself is a chain of nucleotides. Under most
conditions, DNA is double-stranded, consisting of two
such nucleotide chains that wind around each other in
the famous shape known as the double helix. Primers are
single-stranded. They consist of a string of nucleotides
in a specific order that will, under the right conditions,
bind to a specific complementary sequence of
nucleotides in another piece of single-stranded RNA or
DNA.
For PCR, primers must be duplicates of nucleotide
sequences on either side of the piece of DNA of interest,
which means that the exact order of the primers’
nucleotides must already be known. These flanking
sequences can be constructed in the lab, or purchased
from commercial suppliers.
There are three basic steps in PCR. First, the target
genetic material must be denatured-that is, the strands of
its helix must be unwound and separated-by heating to
90-96°C. The second step is hybridization or annealing,
in which the primers bind to their complementary bases
on the now single-stranded DNA. The third is DNA
synthesis by a polymerase. Starting from the primer, the
polymerase can read a template strand and match it with we would isolate the DNA that was 30 base pairs long (5
complementary nucleotides very quickly. The result is cities times 6 base pairs).
two new helixes in place of the first, each composed of
one of the original strands plus its newly assembled
complementary strand.
All PCR really requires in the way of equipment is a
reaction tube, reagents, and a source of heat. But
different temperatures are optimal for each of the three
steps, so machines now control these temperature
variations automatically.
To get more of the DNA you want, just repeat the
process, beginning by denaturing the DNA you’ve
already made. The amount will double every time.
So to selectively amplify the itineraries that start and
stop with our cities of interest, we use primers that are
complimentary to LA and NY. What we end up with
after PCR is a test tube full of double stranded DNA of
various lengths, encoding itineraries that start with LA
and end with NY.
Part III: Select itineraries that contain the correct
number of cities
Strategy: Sort the DNA by length and select the DNA
whose length corresponds to 5 cities.
Our test tube is now filled with DNA encoded itineraries
that start with LA and end with NY, where the number
of cities in between LA and NY varies. We now want to
select those itineraries that are five cities long. To
accomplish this we can use a technique called Gel Part IV: Select itineraries that have a complete set of
Electrophoresis, which is a common procedure used to cities
resolve the size of DNA. The basic principle behind Gel
Electrophoresis is to force DNA through a gel matrix by Strategy: Successively filter the DNA molecules by
using an electric field. DNA is a negatively charged city, one city at a time. Since the DNA we start with
molecule under most conditions, so if placed in an contains five cities, we will be left with strands that
electric field it will be attracted to the positive potential. encode each city once.
However since the charge density of DNA is constant
(charge per length) long pieces of DNA move as fast as
short pieces when suspended in a fluid. This is why you DNA containing a specific sequence can be purified
use a gel matrix. The gel is made up of a polymer that from a sample of mixed DNA by a technique called
forms a meshwork of linked strands. The DNA now is affinity purification. This is accomplished by attaching
forced to thread its way through the tiny spaces between the compliment of the sequence in question to a
these strands, which slows down the DNA at different substrate like a magnetic bead. The beads are then mixed
rates depending on its length. What we typically end up with the DNA. DNA, which contains the sequence
with after running a gel is a series of DNA bands, with you’re after then hybridizes with the complement
each band corresponding to a certain length. We can sequence on the beads. These beads can then be
then simply cut out the band of interest to isolate DNA retrieved and the DNA isolated.
of a specific length. Since we known that each city is So we now affinity purify fives times, using a different
encoded with 6 base pairs of DNA, knowing the length city complement for each run. For example, for the first
of the itinerary gives us the number of cities. In this case run we use L.A.’-beads (where the ‘ indicates
compliment strand) to fish out DNA sequences which
contain the encoding for L.A. (which should be all the
DNA because of step 3), the next run we use Dallas’-
beads, and then Chicago’-beads, Miami’-beads, and
finally NY’-beads. The order isn’t important. If an
itinerary is missing a city, then it will not be “fished out”
during one of the runs and will be removed from the
candidate pool. What we are left with are the are
itineraries that start in LA, visit each city once, and end
in NY. This is exactly what we are looking for. If the
answer exists we would retrieve it at this step.

Compliment

New Yark
Los Angeles Chicago Miami New Yark
LA to CH CH to Mi MI to NY

1)
Magnetic bead
Hibridized DNA
2)

3)

4) Reading out the answer

One possible way to find the result would be to simply
sequence the DNA strands. However, since we already
have the sequence of the city encodings we can use an
alternate method called graduated PCR. Here we do a
series of PCR amplifications using the primer
corresponding to L.A., with a different primer for each
city in succession. By measuring the various lengths of
DNA for each PCR product we can piece together the
final sequence of cities in our itinerary. For example, we
know that the DNA itinerary starts with LA and is 30
base pairs long, so if the PCR product for the LA and
Dallas primers was 24 base pairs long, you know Dallas
is the fourth city in the itinerary (24 divided by 6).
Finally, if we were careful in our DNA manipulations
the only DNA left in our test tube should be DNA
itinerary encoding LA, Chicago, Miami, Dallas, and
NY. So if the succession of primers used is LA &
Chicago, LA & Miami, LA & Dallas, and LA & NY,
then we would get PCR products with lengths 12, 18,
24, and 30 base pairs.