PREFACE

Rapid advancements in the field of Biotechnology require a thorough understanding of underlying principles and essential know how of basic techniques involved in Molecular Biology. Expertise on basic Molecular Biological techniques is considered to be pre-requisite for pursuing advanced level research in this exciting field. In order to keep high academic standard and quality teaching, it is mandatory to have on hands training of students in the various tools and techniques used for exploration of living system. With the same intention, we have attempted to write this book so as to provide complete set of practical exercises covering all the essential basic techniques involved in Molecular Biology. The book has been edited and compiled in the form of an experimental manual which, we hope, is very useful for various graduate and postgraduate students offering the course for their major and minor in Molecular biology & Biotechnology. Students belonging to BSc, B.Tech. , MSc. and M.Tech. degree programmes taking the experimental course in Molecular Biology will find it useful in learning the techniques by performing the experiments given in manual. Authors have experience in teaching the course Techniques in Molecular Biology for last one decade and based on their experiences; the outline of the course manual has been designed. This book includes all the basic paradigms and principles used in proteins based analysis, nucleic acid based analysis and immunological analysis consisting of total 27 exercises. Each practical exercise starts with the brief background for understanding the purpose of doing experiment followed by reagents required, detailed procedure for the experiment and observations to be recorded. Each lab exercise is presented in organized and systematic manner so that the students understand essential concepts while performing the experiments. The project of making manual was initiated at behest of our dynamic and visionary leadership of Professor G.K. Garg, Advisor Biotechnology programme, Pantnagar, who always show the path to perform for academic excellence in the field of science specially emerging field of Biotechnology. Due to his time to time guidance, persuasion and motivation, we are able to bring this manual in the present shape and first time in the hands of our students. We would like to express our deep appreciation to Dr. Anjana Shukla, Dr. Nandita Singh, Mr Subhash Chandra and students of Molecular Biology & Genetic Engineering namely Anupam, Rahul, Dhiraj, Moin, Saroj, Alok, Giriraj, J.S.Arora, Rajiv and Taware Ravindra for helping in completion of the task of preparation of this manual by editing the protocols of every lab exercise. We wish that the manual will help not only to build the concepts but also solve the quest to practice Molecular Biological techniques. Anil, Dinesh, Gohar and Govind

Compiled and Edited by

Dr Anil Kumar, Ph.D.

Associate Professor & Incharge

Dr Dinesh Pandey, Ph.D.

DST Young Scientist

Dr Gohar Taj, Ph.D.

Assistant Professor

Dr G.K.Garg, Ph.D.
Advisor Biotechnology Programme

Department of Molecular Biology & Genetic Engineering College of Basic Sciences & Humanities G.B.Pant University of Ag. & Tech. Pantnagar Uttranchal-263145

NUCLEIC ACID BASED TECHNIQUES 1. Isolation of Plasmid DNA from E. coli bacteria 2. Agarose Gel electrophoresis of DNA 3. Restriction Digestion of DNA 4. Ligation of DNA 5. Extraction of DNA from blood 6. Isolation of Bactrerial DNA 7. Extraction of leaf DNA 8. Extraction of wheat seed DNA 9. Genomic DNA extraction from fungus 10. Purification of DNA by binding and elution from glass or silica particles 11. Saturation or equilibration of the phenol for DNA purification 12. Purification of DNA by phenol chloroform extraction procedure 13. Quantitation of DNA by spectrophotometric method. 14. PCR (Polymerase Chain Reaction) PROTEIN BASED TECHNIQUES 12. Extraction of protein from wheat seeds 13. Extraction of protein from bacterial cells 14. Extraction of total protein from fungal mycelium. 15. Extraction of protein from plant (Brassica) leaves 16.. Quantitative estimation of proteins 17. Dialysis of proteins 18. SDS Polyacrylamide Gel Electrophoresis of proteins IMMUNOLOGICAL TECHNIQUES 19. ELISA 20. Quantitative Precipitin Assay (QPA) 21. Immunization of rabbit with BSA

EXPERIMENT NO.1
OBJECT: Isolation of plasmid DNA from E. coli bacteria INTRODUCTION: Isolation of plasmid DNA from E. coli is a common routine in
research laboratories. Plasmids can be isolated from few milliters of bacterial broth culture. Such isolation is known as minipreparation or miniprep of plasmid DNA. Sometimes, plasmid DNA is needed in large quantities. For this maxi prep is done from few hundred ml bacterial culture. Plasmids are double stranded, circular, self-replicating extra chromosomal DNA molecules. They have a size range of 1-200 kb. Although their replication and inheritance are independent of bacterial chromosome yet they depend upon proteins enoded by bacterial chromosome. Their copy number may vary from 1-700 per cell depending upon ori and cis acting control elements. They generally confer antibiotic resistance to bacteria enabling them to grow in selective antibiotic medium.

In Biotechnology, plasmids are routinely used mainly for gene cloning work. Many plasmid vectors have been developed for this purpose. PBR322 and puc 19 are two such examples. A plasmid cloning vector should have an origin of replication by which it can replicate in its host bacterium , an antibiotic resistance gene by which those bacterial cells can be selected that have that particular plasmid , a selectable marker gene within which there should be multiple cloning site. Any foreign gene can be inserted in to multiple cloning site. Gene insertion causes inactivation of selectable marker gene by which recombinant plasmid can be identified. Some of the examples of common plasmids include the following.

pBR322- a classic example of cloning vector is 4363 bp in length and contains (1) origin of replication,(source-plasmid pMB1)(2) the bla gene, coding for beta lactamase, that confers resistance to ampicillin (4) the tet gene, encoding tetracycline resistance which also contains multiple cloning sites.

pUC 19- most commonly used plasmid vector is high copy number, E. coli plasmids, 2686 bp in length contains (1) replication origin of pMB1 plasmid (2) the bla gene coding for beta lactamase that confers resistance to ampicillin( source plasmid pBR322) (3) the region of E. coli operon containing a CAP protein binding site , promoter Plac, lac repressor binding site and 5 terminal part of lac Z gene encoding the N terminal fragment of beta galactosidase. This fragment whose synthesis can be induced by IPTG is capable of intra allelic alpha complementation with a defective form of beta galactosidase encoded by the host. In the presence of IPTG, bacteria synthesize both fragments of the enzyme and form blue colonies on media with X gal. Insertion of DNA in to the MCS located within lacZ gene inactivates N terminal fragment of beta galactosidase and abolishes alpha complementation. Bacteria carrying recombinant plasmids there fore give rise to white colonies.

pGEMTeasy- This is commonly used for cloning of PCR products. PCR products contain 3A overhangs which can easily be annealed with the 5 T overhangs of plasmid cut with any of restriction endonuclease within MCS. The plasmid contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the a-peptide coding region of the enzyme b-galactosidase. Insertional inactivation of the a-peptide allows recombinant clones to be directly identified by color screening on indicator plates. The pGEMT Easy Vectors also contain the origin of replication of the filamentous phage f1 for the preparation of single-stranded DNA.

Most common use of plasmids is as vectors in which the genes from an organism can be cloned by cutting it with restriction endonuclease and by ligating it. Once gene is inserted into suitable plasmid vector , recombinant plasmid is inserted in to host bacteria by a process called transformation . Recipient bacteria then multiply to give rise clones which contain many copies of same recombinant plasmid.

Principle of plasmid DNA isolation: Plasmids are commonly isolated by alkaline

lysis method. First bacterial cells containing the desired plasmid are grown in a broth medium. The cell pellet is resuspended in a solution that contains glucose/sucrose, EDTA /lysozyme and Tris buffer. This causes disintegration of cell wall and weakening of bacterial cell membrane as osmotic pressure outside the cell increases. Next, Cells are lysed by placing them in a solution that contain alkali (NaOH) and SDS. SDS denatures bacterial proteins and causes dissolution of bacterial cell membrane and NaOH denatures the plasmid and chromosomal DNA and begin hydrolysis of RNA. The preparation is then neutralized by using the concentrted solution of sodium acetate or potassium acetate. Upon neutralization , plasmid DNA renatures rapidly because of its small size and covalent conformation while chromosomal DNA can not renature and it forms an entangled complex in which and denatured proteins are trapped. Most of the

chromosomal DNA and bacterial proteins precipitate along with the SDS complex and are removed by centrifugation. The re annealed plasmid DNA present along with RNA in the supernatant is then concentrated by isopropanol precipitation. Centrifugation will precipitate the plasmid DNA which then can be dissolved in TE buffer. An outline of procedure for plasmid DNA isolation is as follows:

EQUIPMENTS/PLASTICWARES REQUIRED: Centrifuge, Tips, Eppendorf tubes and MATERIAL & REAGENTS: Sucrose, Tris , EDTA, NaOH, SDS, LB medium, Potassium/Sodium acetate, Isopropanol, Inoculation loop STOCK SOLUTIONS: Solution I 15% Sucrose or glucose 25 mM Tris (pH 8.0) 10 mM EDTA Autoclave and store at 40C. Do not autoclave if glucose is being used.

Solution II 0.2N NaOH and 1% SDS Dilute it from the stocks of NaOH and SDS and prepare it fresh before use. Solution III 5M potassium acetate ( pH = 5.2) Take 60 ml 5M potassium acetate. Add 11.5 ml glacial acetic acid. Make it up to 100 ml. Autoclave and store it at 40C. Solution IV Isopropanol

TE buffer: TE buffer contains 10 mM Tris and 1 mM EDTA. TE buffer composition for 100 ml: 10 mM Tris-HCl pH 8.0 - Take 1 ml from stock 1 M Tris-HCl pH 8.0 1 mM EDTA - Take 0.5 ml from stock 0.5 M EDTA pH 8.0 Add distilled water to 100 ml and autoclave it. LB Agar/ Broth preparation Add 10g tryptone, 5g of yeast extract, 10g of NaCl and dissolve gently in 900 ml of water. Adjust pH to 7.0 with 1N NaOH and make the volume to 1000 ml. For LB agar preparation, add 1.5% agar and autoclave. Ampicillin LB media Prepare LB media as above, sterilize by autoclaving. Cool the LB agar/ broth and add 100 g/ml of ampicillin. Add ampicillin to LB only after autoclaving the LB media and cooling at <450C. Antibiotic preparation Dissolve required quantity of the antibiotic in sterile water & filter sterilize it and store at 40C. Make antibiotic fresh, just before use. PROCEDURE: 1. Pick up a single colony from the overnight grown culture of E. coli cells having pUC 19 plasmid and inoculate it into 10 ml LB broth containing ampicillin (50 g/ml). Incubate the inoculated LB using shaker at 370C for overnight. 2. Pipette 1.5 ml culture in a 1.5 ml tubes. 3. Spin for 8-10 min at 6,000 rpm. Discard the supernatant. Invert the vial on blotting paper to drain left over supernatant. Place on ice. 4. Resuspend cell pellet in 100 l of ice-cold solution I. Vortex gently. Place on ice for 5 min and shift to RT. Solution I contains glucose/sucrose, Tris, and EDTA. Glucose/sucrose is added to increase the osmotic pressure outside the cells. Tris is a buffering agent used to maintain a constant pH (= 8.0). EDTA protects the DNA from degradative enzymes (called DNAses) by binding/chelating divalent cations that are necessary for DNAse activity. 2. Thaw and add 200 l of solution II at RT. Mix gently by inverting the tube five times (Do not vortex). Solution II contains NaOH and SDS (a detergent). This alkaline mixture ruptures the cells, and the detergent breaks apart the lipid membrane and solubilizes cellular proteins. NaOH denatures both plasmid DNA and chromosomal DNA . 3. Add 150 l of solution III. Mix gently by inverting the tubes. Place on ice for 5 min. Solution III contains a mixture of acetic acid and potassium acetate. The acetic acid neutralizes the pH, allowing the DNA strands to renature. The potassium acetate also precipitates the SDS from solution, along with the cellular debris. Plasmid DNA renatures and remains in solution but E. coli chromosomal DNA, forms a partially

renatured tangle at this step, in which denatured proteins and SDS are also trapped. The whole complex gets precipitated. 4. Spin for 10 min at 6-8000 rpm. This fractionation step separates the plasmid DNA from the cellular debris and chromosomal DNA in the pellet. Plasmid DNA remains in supernatant. 5. Transfer immediately the supernatant to a fresh epp. tube and add 900 l of solution IV. Mix by inverting to precipitate the DNA. Keep at -200C for overnight. Solution IV is Isopropanol which effectively precipitates nucleic acids, but is much less effective with proteins. A quick precipitation can therefore purify plasmid DNA from protein contaminants 6. Spin for 20 min at 10,000 rpm for 30 min, at 6,000 rpm. Decant the supernatant invert the vial on blotting paper to drain left over supernatant DNA will be seen as white ppt sticking to the side. Dry for 10-15 min at 370C till there is no trace of solution IV. 7. Resuspend the pellet in 20 l of 1X TE (add along the sides); mix by tapping tubes with finger so that DNA goes into the solution. Be sure mixing is complete with intermittent tapping for 20 min. TE buffer has Tris which maintains the pH and dissolves DNA. EDTA chelates Mg2+ ions so that it protects from the action of nucleases. 8. Add RNase A at the concentration of 50 g/ml (to remove RNA) and incubate for 30 min at 370C. 9. Add 3 l of gel loading buffer to prepared DNA and 10 l of control DNA. 10. Load prepared DNA and control DNA samples in separate wells and electrophorese in 0.8% or 1% agarose gel. Upon agarose gel electrophoresis. Plasmid DNA often gives two bands corresponding to nicked circular and supercoiled conformation of plasmid DNA. But sometimes only supercoiled form may be seen. The following image shows an ethidiumbromide-stained gel with uncut plasmid in the left lane and the same plasmid linearized at a single site in the right lane.

OBSERVATION:
Gel preparation: _________ % gel Agarose powder: ________g

Concentrated buffer: _________ml Sample volume ________ul Run conditions: _____min _____volts ______mm Marker migration Stain: _________________________________________ Well no. 1 2 3 4 5 6 7 8 9 10 Amount of plasmid DNA Amount of gel loading dye Total amount of sample loaded

Paste your plasmid DNA photograph here:

Questions :
How much of 0.75 M tris and 0.5 M EDTA stock solutions would be used to prepare 100 ml of TE buffer (10 mM Tris and 1 mM EDTA)

Why are three bands obtained after gel electrophoresis of plasmid DNA? How isopropanol treatment does leads to precipitation of plasmid DNA? How does genomic DNA get separated from plasmid DNA during its isolation procedure? 1. Why is T10E1 buffer is used for dissolution and storage of DNA? 2. What is the role of following solutions in plasmid DNA isolation? 1. solution I 2. solution II 3. solution III

EXPERIMENT NO. 2 AGAROSE GEL ELECTROPHORESIS OF DNA

OBJECTIVE: To check the quality and quantity of DNA by agarose gel
electrophoresis

EQUIPMENTS REQUIRED: Horizontal slab gel electrophoresis apparatus

(Bangalore genei) with power pack system. , casting trays, comb, ultraviolet transilluminator system or gel documentation system.

PRINCIPLE & THEORY:

Electrophoresis is migration of a charged molecule in an electric field in the direction of an electrode so that cationinc (positively charged molecules) move in the direction of cathode (negative electrode) and anionic (negatively charged molecules) move in the direction of anode (positive electrode). When an electric field is applied to an agarose gel in the presence of a buffer solution which will conduct electricity, DNA which is highly negatively charged, will migrate towards the positive electrode i.e. anode. Rate of migration of DNA will depend upon its size and shape. For agarose gel elelectrophoresis, first an agarose gel is prepared in an electrophoresis buffer. To prepare the gel, desired amount of agarose powder is mixed with electrophoresis buffer and then heated in a microwave oven until it is completely melted. After cooling the solution to about 600 C, it is poured into a casting tray containing a sample comb and allowed to solidify at room temperature. After the gel has solidified, the comb is removed, using care not to rip the bottom of the wells. The gel, is inserted horizontally into the electrophoresis chamber and just covered with buffer. Samples containing DNA mixed with loading dyes are then pipeted into the wells, on the surface of agarose gel, the lid and power leads are placed on the apparatus, and a current is applied. In order to know if current is flowing can be confirmed by observing bubbles coming off the electrodes. DNA, since negatively charged, will migrate towards the anode, which is usually colored red. The distance DNA has migrated in the gel can be judged by visually monitoring migration of the loading dyes. Loading dyes have Bromophenol blue and xylene cyanol dyes which migrate through agarose gels at roughly the same rate as double-stranded DNA fragments of 300 and 4000 bp, respectively. When adequate migration has occured, DNA fragments are visualized by staining with ethidium bromide. This fluorescent dye intercalates between bases of DNA and RNA. It is often incorporated into the gel so that staining occurs during electrophoresis, Most commonly; ethidium bromide (final concentration 0.5 g/ml) is added to the gel at the time of its preparation. The gel can also be stained after electrophoresis by soaking in a dilute solution of ethidium bromide. To visualize DNA, the gel is placed on an ultraviolet transilluminator.

FACTORS AFFECTING THE MIGRATION OF DNA FRAGMENTS IN AGAROSE GEL: 1. Molecular weight: Migration of linear DNA Fragments through agarose gels is inversely proportional to the log10 of their molecular weight. If the distance from the well that DNA fragments have migrated is plotted against the log 10 of either their molecular weights or number of base pairs, a roughly straight line will appear. 2. Shape: Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass. Typically uncut plasmids will appear to migrate more rapidly than the same plasmid when linearized. Additionally, most preparations of uncut plasmid contain at least two topologically-different forms of DNA, corresponding to supercoiled forms and nicked circles. 3. Additionally, several factors have important effects on the mobility of DNA fragments in agarose gels, and can be used to advantage in optimizing separation of DNA fragments. Agarose Concentration: By using gels with different concentrations of agarose, one can resolve different sizes of DNA fragments. Higher concentrations of agarose facilite separation of small DNAs, while low agarose concentrations allow resolution of larger DNAs. The image to the right shows migration of a set of DNA fragments in three concentrations of agarose, all of which were in the same gel tray and electrophoresed at the same voltage and for identical times. Notice how the larger fragments are much better resolved in the 0.7% gel, while the small fragments separated best in 1.5% agarose. The 1000 bp fragment is indicated in each lane.

Voltage: As the voltage applied to a gel is increased, larger fragments migrate proportionally faster that small fragments. For that reason, the best resolution of fragments larger than about 2 kb is attained by applying no more than 5 volts per cm to

the gel (the cm value is the distance between the two electrodes, not the length of the gel). Electrophoresis Buffer: Several different buffers have been recommended for electrophoresis of DNA. The most commonly used for duplex DNA are TAE (Trisacetate-EDTA) and TBE (Tris-borate-EDTA). DNA fragments will migrate at somewhat different rates in these two buffers due to differences in ionic strength. Buffers not only establish a pH, but also provide ions to support conductivity. If you mistakenly use water instead of buffer, there will be essentially no migration of DNA in the gel! Similarly, if you use concentrated buffer (e.g. a 10X stock solution), enough heat may be generated in the gel to melt it. Effects of Ethidium Bromide: Ethidium bromide is a fluorescent dye that intercalates between bases of nucleic acids and allows very convenient detection of DNA fragments in gels, as shown by all the images on this page. As described above, it can be incorporated into agarose gels, or added to samples of DNA before loading to enable visualization of the fragments within the gel. As might be expected, binding of ethidium bromide to DNA alters its mass and rigidity, and therefore its mobility. How does ethidium bromide interact with DNA ? Ethidium bromide looks a bit like a base pair and inserts into double stranded DNA between base pairs. It is a powerful mutagen producing a point mutation. Ethidium bromide on its own is weakly fluorescent. Fluorescence occurs because an electron is excited to an upper level (in this case by uv 365nm); when the electron falls back to a lower energy level, that difference in energy is given out as light quanta of lower energy (visible orange light in this case). The fluorescence of free ethidium bromide in solution is low because the electron can trickle between the two energy levels in stages using vibrational energy levels. This alternative pathway reduces number of electrons that follow the fluorescence pathway and so the yield is weak. When ethidium bromide is bound to DNA it is held more rigidly so the pathway giving out low energy quanta is less probable and the fluorescent pathway is favoured.

MATERIAL & REAGENTS: Tris-base, glacial acetic acid, EDTA, Boric acid,
Bromo phenol blue, sucrose, ethidium bromide

Solutions:
1.: Electrophoresis buffer: We can use either 1XTAE or 0.5 X TBE buffer for running agaraose gels. Although 1 X TAE buffer is most commonly used for agarose gel electrophoresis but use of 0.5X TBE buffer, sometimes, gives better resolution than 1X TAE buffer. Recipe for Tris Acetate EDTA (TAE) 50X buffer, 1litre Tris base : 242 g Glacial acetic acid : 57.1 ml

0.5M EDTA (pH 8.0) : 100 ml Make the volume up to 1000 ml with double distilled water. Autoclave and store at RT. Working concentration is 1X: - 0.04M Tris-Acetate, 0.001M EDTA OR Recipe for Tris Borate EDTA (TBE) 10X buffer, 1litre Tris base : 108 g Boric acid : 55 g 0.5M EDTA : 40 ml (pH 8.0) Make the volume of the solution up to 1000ml with ddw. Autoclave and store at RT. Working concentration is 0.5X: 0.090M Tris-borate, 0.001M EDTA 0. 5 x TBE can be used for agarose gels 1 x TBE is the standard running buffer for DNA separation in polyacrylamide gels 2. 6X Gel loading buffer: 0.25% Bromophenol blue, 0.25% xylene cyanol, 40% (w/v) sucrose or glycerol prepared in working concentration (1 X) of TAE OR 0.5X TBE. Filter sterilize and store at 4oC. 3. Ethidium bromide solution (10 mg/ml) Dissolve 10mg Ethidium Bromide in 1ml double distilled water. Working concentration of Ethidium Bromide is 0.5 to 1.0 g/ml in agarose gel. This solution should be stored at 4oC in dark. WARNING: ETHIDIUM BROMIDE IS A POWERFUL MUTAGEN. ALWAYS WEAR GLOVES WHEN WORKING WITH IT.

PROCEDURE
A. Gel preparation 1. If 100ml gel has to be prepared, weigh following amount of electrophoresis grade agarose and melt it in electrophoresis buffer (1 XTAE or 0.5X TBE) by heating with continuous swirling till a clear solution is obtained. For 1% agarose gel : melt 1g agarose in 100 ml 1X buffer For 0.8% agarose gel : melt 0.8g agarose in 100 ml 1X buffer (Note: Most agarose gels are made between 0.7% and 2%. A 0.7% gel will show good separation (resolution) of large DNA fragments (510kb) and a 2% gel will show good resolution for small fragments (0.21kb). Most of the time, 0.7-0.8% gel is prepared for running plasmid DNA and 1.0 % gel is prepared for running genomic DNA. ) 2. Place the cellophane tape around the casting tray. For Genei Horizontal gel electrophoresis this step is not required. (Note : Casting trays come in various sizes. The type of casting tray , used will depend upon the size of agarose gel required )

3. Place the comb in to the casting tray with the help of stand. Adjust the distance between bottom of comb and casting tray with the help of a glass slide. (Note : Combs come in various sizes. The use of comb depends on the volume of DNA to be loaded and the number of samples. Combs with many tiny teeth may hold 10L.But for loading larger volumes , combs with bigger teeth may be used. )

4. Pour the molten agarose on to the gel casting platform with a comb is inserted, ensuring that no air bubbles have entrapped underneath the comb.

5. After the gel hardens, the comb is withdrawn taking care that the wells do not tear off and tape is removed carefully.

6. Place the gel in electrophporesis tank.

7. The gel tank is filled with sufficient volume of electrophoresis buffer in which gel should be submerged.

B. Loading and running the gel 1. DNA samples are prepared in 6X gel loading dye and loaded into the wells with micro-pipette

2. Electrophoresis is carried out at a constant voltage of 50 Volts . Gel is allowed to run until marker dye has migrated about 75% toward the positive pole. DNA fragments appear as blue bands. 3. After completion of electrophoresis, gel is stained with ethidium bromide (5 ug/ml) for 10-15 min at RT. ( Note : If ethidium bromide is included in gel , then there is no need to stain or destain , the gel can directly be visualized under UV light ). WARNING: ETHIDIUM BROMIDE IS A POWERFUL MUTAGEN. ALWAYS WEAR GLOVES WHILE HANDLING GELS CONTAINING ETHIDIUM BROMIDE. 4. The gel is then destained with deionized water. C. 1. 2. Visualization and photography of DNA in agarose gel Keep the agarose gel on platform of UV transilluminator and switch on transmitted UV light to visualize EtBr stained DNA bands in the gel. Take Photograph by a CCD camera attached with a computer.

(Be aware that DNA will diffuse within the gel over time, and examination or photography should take place shortly after cessation of electrophoresis)

OBSERVATION:
Gel preparation : _________ % gel Agarose powder : ________g Concentrated buffer : _________ml Sample volume ________ul Run conditions : _____min _____volts ______mm Marker migration Stain : _________________________________________ Well number 1 2 3 4 5 6 7 8 9 10 Paste the photograph of agarose gel, here: Amount of sample Amount of gel loading dye Total amount of sample loaded

Comments :

TROUBLESHOOTING DNA AGAROSE GEL ELECTROPHORESIS

PROBLEM: Faint or no bands on the gel CAUSE /REMEDY:

There was insufficient quantity or concentration of DNA loaded on the gel. Increase the amount of DNA. The DNA was degraded. Avoid nuclease contamination. The DNA was electrophoresed off the gel. Electrophorese the gel for less time, use a lower voltage, or use a higher percent gel. Improper Wavelength light source was used for visualization of ethidium bromide-stained DNA. Use a shortwavelength (254 nm) light for greater sensitivity..

PROBLEM: Smeared DNA bands CAUSE/REMEDY:

The DNA was degraded. Avoid nuclease contamination. Too much DNA was loaded on the gel. Decrease the amount of DNA. Improper electrophoresis conditions were used. Do not allow voltage to exceed ~20 V/cm. Maintain a temperature <30 C during electrophoresis. Check that the electrophoresis buffer used had sufficient buffer capacity. This is done by checking the pH in the anode and cathode chambers. There was too much salt in the DNA. Use ethanol precipitation to remove excess salts, prior to electrophoresis. The DNA was contaminated with protein. Use phenol extractions to remove protein prior to electrophoresis. Small DNA bands diffused during staining. Add the ethidium bromide during electrophoresis.

Review Questions:
1. In order to resolve a 500 bp DNA fragment, which % of gel should be used and why? 2. Why is sucrose added in bromophenol dye solution? 3. What is agarose? What is the relationship between agarose concentration and size of DNA, resolved? 4. Fill in the blanks : 1. Xylene cyanol migrates corresponding to ..bp of DNA 2. Bromophenol blue migrates corresponding to ..bp of DNA. 3. Agarose is derived from.. 4. ..X TAE and..X TBE buffer could be used for gel electrophoresis of DNA. 5. What is the reason for following : 1. Smeared bands 2. Faint or no band 6. Calculate the molecular weight of dsDNA molecule containing 1200 nucleotides. 7. How do molecular biology grade reagents differ from analytical grade reagents? 8. How does ethidium bromide interact with DNA and why does it give fluorescence when observed under UV light? 9. On which factors electrophoretic migration depend upon

10. The following curves depict the relationship between agarose concentration and size of DNA separated.

Genomic DNA

Plasmid DNA

Notreatment ECOR I No treatment Bam HI EcoRI Hind III 1 2 3 4 5 6 7 8 i) What is the relationship between agarose concentration and size of DNA separated? ii) How does voltage field influence DNAs mobility? iii) Does buffer concentration and type also influence the DNAs mobility? iv) Can temperature also influence the mobility? 11. What are the critical factors influencing the migration of nucleic acid? The following electrogram of various kinds of DNA sample is given herewith:

DNA size (Rb) 20 Kb

a) Write your interpretation. b) How will you ensure the good quality of plasmid DNA? c) What is the reason for getting 3 bands in plasmid DNA electrophoresis? Mention the

EXPERIMENT NO. 4. RESTRICTION DIGESTION OF DNA OBJECTIVE : To determine the activity of restriction endonuclease EcoRI PRINCIPLE AND THEORY : Restriction enzyme : Restriction enzymes are classified as endonucleases. Their biochemical activity is the hydrolysis ("digestion") of the phosphodiester backbone at specific sites in a DNA sequence. Nomenclature: Restriction enzyme names are based on a species-of-origin. For example: BamHI (from Bacillus amyloliquifaciens (H)) Sma I (from Serratia marcescens S) Mlu I (from Micrococcus luteus) Hpa I (from Haemophilus parainfluenzae) Recognition sequences : For example an enzyme called BamHI searches for the sequence 5-GGATCC-3 in double-stranded DNA . When the sequence is located, the enzyme BamHI digests the phosphodiester backbone in two specific places - between the pair of G nucleotides on each strand. For example , following DNA sequence
5-GAGGATACCACCAGGGTTACAGGATAGGAGTCAGGATCCAGAGGACCTAGGATACCTC-3 3-CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAGGTCTCCTGGATCCTATGGAG-5

is digested by Bam HI (at the site shown in red) to give two fragments of DNA...
GAGGATACCACCAGGGTTACAGGATAGGAGTCAG GATCCAGAGGACCTAGGATACCTC

CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG

GTCTCCTGGATCCTATGGAG

The enzyme finds the sequence GGATCC on each strand (note that it reads the same on the complementary strand and so the sequence has a two-fold axis of symmetry, or is "palindromic" and nicks the phosphodiester backbone between the G nucleotides. The hydrogen bonds break naturally, from the energy of thermal motion in the solution and the two fragments move away from each other.
5'-GAGGATACCACCAGGGTTACAGGATAGGAGTCAG-3' 3'-CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG-5'

and
5'-GATCCAGAGGACCTAGGATACCTC-3' 3'-GTCTCCTGGATCCTATGGAG-5'

The two fragments have newly-exposed 5' and 3' ends. (And nearly all restriction enzymes leave a phosphate on the exposed 5' end. The enzyme Nci I, an exception to the rule, leaves a 3' phosphate). In above example of digestion with the enzyme BamHI, it's obvious that the newly created ends of the DNA do not line up evenly with each other. On each fragment, there is a four-nucleotide sequence 5'-GATC that hangs off the end and doesn't base-pair (because the other fragment has broken away and moved off).

Since the one end that hangs over past the other has a free 5' end, we say that BamHI digestion creates a "5' overhanging end" which we sometimes call a "5' overhang." Another term that means the same thing is to say that overhanging ends are "cohesive ends" or "sticky ends" meaning that they could hydrogen bond to other compatible complementary strands (compatible in the sense of Watson-Crick base pairing).

Some restriction enzymes leave a 3' overhanging end. An example would be the enzyme Sac I: Sac I searches for the sequence GAGCTC on each strand (once again, GAGCTC reads the same off of both strands because the sequence is palindromic). The enzyme breaks the phosphodiester bonds between the fifth and sixth nucleotides in the recognition sequence. 5'-GAGCTC-3' 3'-CTCGAG-5' Sac I ----> 5'-GAGCT -3' + 3'-C -5' 5'C-3' 3'- TCGAG-5'

Some restriction enzymes leave a blunt end.

DNA molecule has ends that line up evenly with each other (i.e. neither end is overhanging) are known as "blunt" (meaning "not sharp") or "flush" (meaning "level or even"). For example, the enzyme Sma 1 cuts in the middle of the six nucleotide recognition sequence: 5'-CCCGGG-3' 3'-GGGCCC-5' Sma I ----> 5'-CCC -3' 3'-GGG -5' + 5'- GGG-3' 3'- CCC-

Not all restriction enzymes recognize sequences that are palindromic. For example, the enzyme Bsr I cuts as follows (where "N" can represent any nucleotide): 5'-ACTGGNN-3' 3'-TGACCNN-5' Bsr I ----> 5'-ACTGGN 3'-TGAC N-3' CNN-5'

The reason this is said to not be a palindromic sequence is that the two strands read differently in their antiparallel directions. The top strand is 5'-ACTGGNN while the bottom strand is 5'-NNCCAGTT. Some restriction enzyme sequences cut outside of their recognition sequence An example of this is the enzyme Bsr I, just described. 5'-A C T G G N^N-3' 3'-T G A C^C N N-5'

On one strand, the enzyme breaks the phosphodiester backbone between the two unspecified "N" bases must 3' to the ACTGG. Some enzymes have split recognition sequences Consider the enzyme Asp 700, with the restriction enzyme recognition sequence: GAANN^NNTTC The 6 nucleotides of recognition sequence is split - palindromic, with the four internal nucleotides not specified. Some enzymes accept degenerate sequences We've been using "N" nucleotides in our recognition sequences, but the N is obviously non-specific. There are enzymes that have partial degeneracies in their recognition sequence. An example of this is Aha II, recognizing the sequence GR^CGYC, where R = G or A, and Y = T or C. For Aha II then, the following are all acceptable recognition sequences: GG^CGCC GA^CGCC GG^CGTC GA^CGTC The length of recognition sequence can vary from 4 to 8 base pairs. A 4bp recognition will occur on average every 44 = 256 bp in random sequence DNA. Whereas , a 6 bp recognition sequence will occur on average every 46= 4096 bp in random sequence DNA. Some restriction enzymes cut DNA at methylated sites: Dpn I enzyme, digests the sequence GATC only if the A is methylated. There are several isoschizomers of Dpn I . Dpn I

Methyl | GA^TC

or both A and C methylated:

Methyl Methyl | | GA^TC

but not with A unmethylated Mbo I

^GATC or Methyl | ^GATC

but not if the A is methylated, or the C is hydroxymethylated

Sau3AI

^GATC
or:

Methyl | ^GATC
will both digest, but not if the C is methylated:

Methyl | ^GATC

Enzymes with recognition sequences from 4 to 8 nucleotides in length each have uses in genetic engineering.

6-cutters (i.e. enzymes that have recognition sequences specified by six nucleotides) are good for day-to-day cloning work: because there sites are frequent enough. An example of a 6-cutter is HindIII (A^AGCTT) which cuts the genome of bacteriophage lambda (48 kbp) at 7 sites. 8-cutters are good for cutting chromosomes into specific pieces that are still quite large. PacI might cut the E. coli chromosome into only about 20 pieces, for example, whereas BamHI might cut it into about 300 pieces. It would be impractical to use a 6-cutter enzyme to obtain a specific fragment of a yeast chromosome, because too many small fragments would be generated during restriction digestion. An 8-cutter might cut infrequently, generating larger and more useful products. An example of an 8-cutter is NotI (GC^GGCCGC) - the NotI recognition sequence is not present in the genome of bacteriophage lambda. 4-cutters are good for experiments where we want the possibility of cleavage at many potential sites. For example, if we want to get a collection of random DNA fragments, some of which may contain a gene of interest, we can perform a partial digestion (not all sites are cleaved due to limitation in enzyme activity) using a 4-cutter. One that is commonly used for this purpose is Sau3AI, which cleaves: 5'-NGATCN-3' 3'-NCTAGN-5' Sau3AI ----> 5'-N GATCN-3' 3'-NCTAG N-5'

There are 116 Sau3AI sites in the genome of bacteriophage lambda.

Principle & theory of restriction digestion: Definition of unit : One unit enzyme is defined as the amount of enzyme required to completely digest one g of lambda DNA in a reaction volume of 50 l in 1 hr under optimal conditions of salt, pH and temperature. All digestions are performed at 370C, unless noted otherwise. Requirement for restriction digestion: There are two main requirements for restriction digestion : 1. A double-stranded DNA sequence containing the recognition sequence. 2. Suitable reaction conditions for digestion which include temperature , use of suitable buffer system , and proper ionic conditions. Factors which influence restriction digestion of DNA are : 1. Nature of DNA : Restriction enzymes activity depends upon Base distribution in natural DNA. Tertiary structure of DNA. Base composition of the flanking sequence.

The position of cleavage site with respect to each other. DNA methylation is also an important element of a restriction digestion so it is advisable to check the amount of enzyme needed to cut the substrate to be cleaved, prior to the actual experiment. 2. Temperature : Most restriction enzymes function at 370 C, however Sma I is an exception. Other examples of temperature exceptions are Apa I (30 C), Bcl I (50 C), BstEII (60 C), and Taq I (65 C). Taq I, is a restriction enzyme from the same type of organism that produces Taq polymerase (Thermophilus aquaticus, or Thermus aquaticus). 3. Buffer system Tris-HCl is the most commonly used buffering agent in incubation mixtures. This buffer system is markedly temperature dependent. The change in pH/100C is approx. 0.3. 4. Ionic Environment Mg2+ ions are an absolute requirement for all R.Es. The addition of other salt components depends on the different nucleases. Some times the presence of BSA in the rear mixture has the crucial influence on the activity of R.Es because it stabilizes the enzymes, binds some impurities, prevents the enzyme adsorption to the tube. Some examples of restriction enzymes and their reaction conditions are given below: 1. BamH1: Recognition sequence : G GATCC Origin : Bacillus amiloliquifaciencs H. Assay buffer : B + BSA 100 g/ml 1X buffer 10 mM Tris HCl (pH 8.0) 100 mM NaCl 10 mM MgCl2 1 mM DTT Incubation temperature : 370C Activity : 10 units/ l 2. Kpn I: Recognition sequence : GGTAC C Origin : Klebsiella pneumoniae Assay buffer : L + BSA 100 g/ml 1X buffer 10 mM Tris HCl (pH 7.4) 10 mM MgCl2 1 mM DTT Incubation temperature : 370C Activity : 10 units/ l 3. Sac I : Recognition sequence : GAGCT C Origin : Streptomyces achromogenes

1X buffer 10 mM Tris HCl (pH 7.4) 10 mM MgCl2 1 mM DTT Incubation temperature : 370C Activity : 10 units/ l Assay buffers provided are 10 x BSA provided is 10 mg/ml i.e. 100X stock Star activity: A cautionary note about restriction enzyme buffer conditions is appropriate at this point. Some restriction enzymes exhibit what are called "relaxed" specificity or "star" activity when they are used under the wrong buffer conditions. For example, EcoRI, which normally only recognizes the sequence G^AATTC, will exhibit EcoRI-star activity if the ionic conditions are too low (e.g. below 50 mM), if the concentration of glycerol is too high, or if too many units of enzyme are added. These "star" activities of EcoRI are N^AATTN and R^RAYY. BamHI (G^GATCC), which we have been discussing, has star activity under similar nonoptimal conditions, and will cause recognition at G^GATCN or G^RATCC Prototype , Isoscizomers and Neoschizomers: A prototype is the first or a newly discovered restriction endonuclease that possesses a unique recognition specificity for DNA. Isoschizomers are restriction enzymes with the same recognition and cleavage site but are isolated from different bacterial strains and in many cases may require different reaction conditions (buffer, temperature). They possess different sensitivity to substrate methylation as well as contaminants. For example: Prototype MboI Isoschizomer Bsp143I ^GATC ^GATC sensitive to dam methylation NOT sensitive to dam methylation reaction buffer R+ reaction buffer Y+/Tango

Assay buffer BSA 100 g/ml

Neoschizomers are restriction enzymes that recognize the same nucleotide sequence as their prototype but cleave at a different site. In some special applications this is a very helpful feature. For example:

Prototype MaeII Neoschizomer TaiI

A^CGT ACGT^

produces DNA fragments with a 2-base 5' extension produces DNA fragments with a 4-base 3' extension produces DNA fragments with a 4-base 3' extension produces DNA fragments with a 4-base 5' extension

Prototype ApaI Neoschizomer Bsp120I

GGGCC^C G^GGCCC

Tips to use R.E. Storage & Use : For longer periods, store the RE & RE buffers at -20C. REs should be kept on ice when they are not in freezer.Thaw the assay buffer completely before using. Preparation of reaction mixture : The enzyme should always be the last component added to the reaction mixture. The substrate DNA should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or excessive salts, all of which can interfere with R.E. activity. The R.E : DNA : reaction volume ratio according to the unit definition is 1 u : 1 g: 50 l. Smaller volumes are more susceptible to pipetting errors. Ensure thorough mixing for complete digestion by gentle up and down by pipetting and a short spin in microcentrifuge. Dilution of enzyme : Enzyme should be diluted using respective dilution buffer. The diluted enzyme should be consumed the same day. The termination of the reaction : A simple, reversible way to a stop restriction reaction is by adding EDTA, which chelates Mg2+, thereby preventing catalysis. If further manipulations of the digested DNA are to be performed, the restriction endonuclease should be inactivated. Phenol/chloroform extraction and ethanol precipitation is an irreversible method for inactivation and removal of all restriction endonucleases; however, a more convenient method is thermal inactivation. Most restriction enzymes can be inactivated by incubation at 65C for 20min. Others remain active at 65C but lose their cleavage ability at a higher temperature. Even many thermophilic enzymes that show optimal activity at 5055C can be inactivated at 80C in 20min

Stability during Prolonged Incubation The stability of restriction endonucleases in a reaction mixture depends upon the nature of the enzyme, buffer composition and incubation temperature.

If restriction endonucleases retain their activity in the reaction mixture for more than one hour, less enzyme can be used by extending the incubation period MATERIALS & REAGENT : Restriction endonucleases, Assay buffer, sterile distilled water, Pipette tips, microfuge tubes, pipette tips, tracking dye, agarose, Ethidium bromide

PROCEDURE: 1. Remove the vial containing restriction enzyme (EcoRI), substrate DNA, assay buffer form the fridge and keep in the ice bucket. 2. Set up a restriction digestion as follows using 1.5 ml microfuge tube Substrate DNA 10 X buffer Restriction enzyme BSA dd water Total 3 l (10 ug) 2.5 l 2 l (20 units) add as per requirement 17.5 l 25 l

3. Now mix the content of the vial containing enzyme, DNA and assay buffer by tapping for few seconds or briefly spin at low speed in a microcentrifuge. 4. Incubate the vial in a 370C waterbath for 1 hour. 5. Keep the sample at 650C for 20 min. to heat inactivate the enzyme. 6. Mean while prepare 1% agarose gel and keep the gel ready for loading samples. 7. After 1h. remove the vial from 370C, load it onto gel along with marker and carry out gel electrophoresis.

Safety guidelines
1. Ethidium bromide is a powerful mutagen. Always wear gloves while handling it or during handling of gels containing ethidium bromide. 2. Take proper eye protection while viewing gels through UV transilluminator as UV light is harmful to eyes and body tissues. OBSERVATION : Mixture for restriction digestion 1. DNA =

2. 3. 4. 5. 6.

Restriction enzyme = Restriction buffer = BSA = distilled water Total volume =

Data table : Well no. Sample DNA Amount sample of Amount of Total loading dye amount

RESULT & INTERPRETATION : Paste the gel photograph here :

Comments : TROUBLESHOOTING: 1. Undigested or incompletely digested DNA Nature of DNA. The number of units added to the reaction should be adjusted according to the varying cleavage rates of DNA substrates. Impure DNA. DNA preparations, especially minipreparations, may contain contaminants such as

phenol, chloroform, ethanol, detergents, EDTA, salts, that might partially or completely inhibit the activity of a restriction endonuclease. If the enzyme cleaves a particular substrate poorly, the activity of the enzyme should be checked using lambda DNA as well as the test DNA mixed with lambda DNA.

. Recognition sequences. If the enzyme does not cleave the substrate at all, check whether the DNA sequences recognized by that particular endonuclease are really present in the DNA substrate tested. Enzyme sensitivity to substrate methylation. Each restriction endonuclease is inhibited by the methylation of one particular nucleotide in the recognition sequence. The methylation of other nucleotides in the target sequence might partially or completely inhibit the activity of enzyme. Most laboratory strains of E.coli used for plasmid preparations contain two sitespecific DNA methylases: Dam and Dcm. Enzyme sensitivity to Dam or Dcm methylation is indicated in the catalog. In the DNA of eukaryotes, the cytosine residues in the CG sequences are often methylated. Cleavage by some restriction endonucleases may be affected by EcoKI or EcoBI methylation. When the DNA is digested poorly, the test substrate should be checked for any methylation and it should be noted whether the restriction endonuclease used is one which is sensitive to that methylation. Improper reaction conditions. An enzymatic reaction is affected by the following conditions: incubation temperature, buffer ionic strength and pH, Mg2+ concentration. Sometimes the presence of BSA in the reaction mix has a crucial influence on enzyme activity, because it stabilizes the enzyme, binds some impurities and prevents enzyme adsorption on the test tube surface. Reaction conditions for each endonuclease are indicated in the products Certificate of Analysis. If possible, the recommended reaction buffer, supplied with the enzyme, should be used. Low enzyme activity may sometimes be due to deterioration of the reaction buffer; in such cases, fresh buffer solves the problem. Improper dilution or addition of enzyme. In order to obtain the correct concentration, enzymes are often diluted prior to addition to the reaction mixture. We recommend the following dilution buffer: 20mM potassium phosphate buffer (pH 7.4), 200mM KCl, 1mM EDTA, 7mM beta-mercaptoethanol, 10% glycerol and 0.2mg/ml BSA. After dilution with this buffer, the enzyme should be used within a day. If you wish to store the enzyme, the enzyme storage buffer or dilution buffer, containing 50% glycerol, should be used for dilution. Some laboratory manuals recommend dilution of enzymes with 1X reaction buffer before addition to the DNA. Such dilution might partially or completely inactivate the enzyme, especially if the reaction buffer has low ionic strength and contains no stabilizing agents. Always add the restriction endonuclease last to the reaction mixture. High glycerol concentration. Some restriction endonucleases (Alw21I, BpiI, Bsp68I, BspTI, Eco32I, Eco91I, EcoRI, Hin6I, HinfI, Mph1103I, Mva1269I, NcoI) are very sensitive to the

concentration of glycerol in the reaction mixture. Since Fermentas restriction enzymes are supplied in 50% glycerol, the enzyme should comprise not more than 1/10 of the final reaction volume (i.e. no more than 5% glycerol). Partially or completely inactivated enzyme. If reaction conditions and substrate correspond exactly to those indicated in the product's Certificate of Analysis and the enzyme still fails to cleave or its activity is lower than indicated in the product's Certificate of Analysis, the enzyme has probably been inactivated due to improper handling.

2. Additional bands atypical for the banding pattern of a particular substrate

Incomplete digestion. Enzyme star activity. The enzyme is contaminated with another restriction endonuclease. DNA preparation tested is the mix of two different DNAs. Incomplete digestion. Sometimes it is difficult to distinguish between an atypical banding pattern and partial digestion. In partial digestion, additional low-intensity bands are present above the expected bands on the gel and no additional bands are present below the smallest expected fragment. These additional bands disappear when the incubation time or amount of enzyme is increased. Enzyme star activity. Under certain conditions (low ionic strength, high pH of the reaction buffer, high enzyme concentration, Mn2+ instead of Mg2+, organic solvents), some restriction enzymes relax their substrate specificity. In addition to the normally recognized sequences, they begin to cleave the substrate at other sites. In the case of star activity, additional DNA bands on the gel should be lower than the expected bands and there should be no additional bands higher than the largest expected fragment. Addition of more enzyme or prolongation of the incubation time results in an increase in intensity of the additional bands and a decrease in intensity of the typical banding pattern. In order to avoid star activity, less enzyme should be added (no more than 10-fold excess of recommended), the reaction should be performed in the recommended buffer (sometimes designed specially to suppress star activity). Too high concentration of glycerol (more than 5%) in the reaction mixture should be avoided (glycerol is introduced into the reaction mixture together with the enzyme). The enzyme is contaminated with another restriction endonuclease. If the incorrect banding pattern persists after following all of the above recommendations (especially if additional bands due to smaller fragments than expected are obtained), the enzyme might have become contaminated with another restriction endonuclease, due to improper handling. Sometimes the reaction buffer, DNA preparation or the "stop" solution may be the source of contamination. DNA preparation tested is the mix of two different DNAs.

3. Diffused DNA zones - gel shift

Impure substrate. Impure enzyme. Protein binding to DNA sometimes results in a band shift in agarose gels. Buffer bacterial growth. Impure substrate. One should incubate the substrate DNA without the enzyme and with the other restriction endonuclease for control. Impure enzyme. One should verify enzyme activity using the substrate indicated in the product's Certificate of Analysis. The presence of diffused bands indicates enzyme contamination due to improper handling in the laboratory. Protein binding to DNA sometimes results in a band shift in agarose gels. This may be avoided by incubating the samples with 0.1% SDS (final concentration) at 65C for 10min prior to electrophoresis. Buffer bacterial overgrowth. All buffers containing BSA should be stored at -20C. In order to avoid the risk of bacterial growth, do not store buffers containing BSA at +4C for periods longer than one week. If buffers are to be stored at +4C they should be aliquoted into small portions and the main stock should be kept at -20C.

Review Questions :
What are different types of restriction endonucleases ? Why are type II restriction enzymes are used in gene cloning experiment ? Calculate the expected sizes of the DNA fragments from the following digests of a 2 kb fragment . 6 base cutter 4 base cutter 8 base cutter Give the origin and functions of the following : i. EcoRI ii. Sac I iii. Kpn I 1. Prepare the reaction mixture for restriction digestion usingfrom components from following stock solutions : DNA 2 mg / ml BSA- 10 mg / ml Reaction buffer 10 X Bam H I 10 u/ul

2. 3. 4.

5. 6. 7. 8.

Indicate the order in which these reagents should be added. A student wanted to prepare the 0.5 M EDTA stock solution . He weighed the desired amount of EDTA chemical and tried to dissolve in water but EDTA did not dissolve. Can you help him in preparation of stock ? What is the probability of occurrence of sites on DNA for a EcoRI restriction enzyme ? Two restriction digestion experiments were performed and their restriction digestion products were run on gel. The products of one experiment were revealed in the form of smear whereas two bands were obtained from second experimental products. Interpret the difference between the two results? Moles of ends generated by restriction endonuclease cleavage of 10 umoles of linear DNA molecules containing 5 sites. What are isoscizomers ? How many restriction sites will be present in a DNA containing 5000 bp for restriction enzymes which are either tetramer or hexacutter ? How will you prepare a reaction mixture for a restriction digestion containing components from the following stock solutions? DNA 2mg/ml Reaction butter 10x Bam HI 20u/ul Indicate the order in which these reagents should be added

EXPERIMENT NO. 5 OBJECTIVE: LIGATION OF RESTRICTED DNA INTRODUCTION Ligation of DNA fragments is done by using DNA ligases. DNA ligase catalyzes the formation of phosphodiester bonds between juxtaposed 5 phosphate and a 3 hydroxyl terminus of double stranded DNA. It can repair single stranded nicks in double stranded DNA and join double stranded DNA restriction fragments having either blunt ends or homologous cohesive ends. Two types of DNA ligases are used for carrying out ligation : E. coli ligase and T4 ligase. These enzymes differ in two important properties. One is the source of energy for ligation. T 4 ligase uses ATP, while E. coli ligase uses NAD+. Another important difference is their ability to ligate blunt ends; under normal reaction conditions, only T4 DNA ligase can ligate blunt ends while E. coli ligase cannot. PRINCIPLE & THEORY: T4 DNA ligase, product of gene 30 of phage T4, was originally purified from phage infected cells of E.coli. Using ATP as a cofactor, T4 DNA ligase catalyzes the repair of single stranded nicks in double stranded DNA and joins double stranded DNA restriction fragments having either blunt or cohesive ends. It is the only ligase that efficiently joins blunt end termini under normal reaction conditions. Ligation of cohesive ends is usually carried out at 120C to 150C to maintain a good balance between annealing of the ends and activities of the enzyme. Higher

temperature makes it difficult for the ends to anneal, whereas lower temperature diminishes ligase activity. Blunt end ligations are typically performed at room temperature since annealing is not a factor (the enzyme is particularly stable above 300C). Blunt end ligation require about 10 to 100 times more enzyme than cohesive end ligations to achieve an equal efficiency.Use of 50% (w/v) PEG 4000 solution greatly increases blunt end ligations.

Ligation of two pieces of DNA

APPLICATIONS OF DNA LIGASES T4 DNA ligase is most commonly used DNA ligase. It efficiently ligates bluntend termini and is extensively used in gene cloning experiments.

MATERIALS PROVIDED
1. T4 DNA ligase 2. Lambda DNA EcoRI digest 3. 2X ligase buffer 4. Agarose 5. Specially graduated capillaries 6. Capillary dispenser 7. 1.5 ml tubes 8. Gel loading dye 9. Gel running buffer 10. Staining dye 1 l 100 l 100 l 4g

PROTOCOL /PROCEDURE:
1. Thaw the ligase assay buffer and the lambda DNA EcoRI digest completely. Place on ice.

2. Add 10 l of lambda EcoRI digest to T4 DNA ligase placing on ice. 3. Add 10 l of 2 X ligase assay buffer and mix by tapping. (spin the vial in a small centrifuge if available). 4. Incubate 2 h at 160C in present water bath. 5. Add 5 l of gel loading dye. 6. Pipette 10 l of lambda DNA digest (control) and 5 l of gel loading dye. 7. Meanwhile prepare 1% agarose gel. 8. Load ligation control digest (6th step control) in 1% agarose gel and electrophorese.

FLOW CHART T4 ligase Add

10 l lambda EcoRI digest Add 10 l of 2X ligase buffer. Mix well Incubate for 2h at 160C Add

5 l of gel loading dye Electrophorese in 1% Agarose with control digest. OBSERVATION : Preparation of ligation mix : Mixture for ligation 1. Restricted DNA = 2. Ligase = 3. Ligase buffer = 4. distilled water 5. Total volume = Data table : Well no. Sample DNA Amount sample of Amount of Total loading dye amount

RESULT: Paste the photograph of gel showing the ligation of lambda DNA digest.

Safety precautions: 1. Use gloves and goggles when handling DNA and ethidium bromide. 2. DNA to be used for ligation should be pure and quantified. Review Questions 1. What are two different types of DNA ligases commonly used in Molecular Biology experiments? 2. Ligation is ATP dependent intramolecular reactions why?

EXPERIMENT NO. 7. EXTRACTION OF DNA FROM BLOOD

OBJECTIVE: PRINCIPLE:

To isolate high molecular weight genomic DNA from blood.

Blood is a colloidal solution which contains a number of cells, platelets and other components. It is also a good source of DNA preparation because it is easily available and can be stored for a long time. Blood lymphocytes serve as the source of genomic DNA. The principle for isolation of genomic DNA is similar to that of bacterial cells except that here a detergent i.e. SDS is used to lyse the cells as these are devoid of cell wall. Blood cells are first collected by centrifugation and washed with High TE buffer so as to completely wash off contaminating proteins and other factors. Since blood cells do not have cell wall , they are always kept in a buffer that maintains isotonic condition till further lysis. Lysis is achieved by treatment of blood cells with SDS and proteinase K which completely disrupt the cell membrane. After that the genomic DNA is extracted wth phenol chloroform and then concentrated by using isopropanol precipitation. After isolating the genomic DNA , it should be checked by running on to 1% agarose gel and then quantitated afterwards to find out the yield of DNA. A SAMPLE GEL FOR GENOMIC DNA ISOLATION

REQUIREMENT: Tris-base, EDTA, proteinase K, NaCl, Phenol, Chloroform, isoamyl alcohol, ethanol. SOLUTIONS Stocks :
1. 1 M Tris Cl buffer (pH 8.0), 100 ml Dissolve 12.114g of tris-buffer in 80 ml water, adjust the pH to 8.0 by 6N HCl and finally make the volume up to 100 ml. Autoclave and store at RT. 2. 0.5M EDTA (pH 8.0),100 ml Dissolve 18.612g of EDTA Na2 in 80 ml of double distilled water (add 10N NaOH to make the pH 8.0, so that EDTA dissolves completely. Make up the final volume to 100ml. Autoclave and keep at RT. 3. 10 N NaOH, 50 ml Dissolve 20g NaOH in 30 ml autoclaved double distilled water and make the final volume up to 50 ml, and store at RT. 4. 1M NaCl, 100 ml Dissolve 5.85g NaCl in 80 ml water and finally make the volume up to 100 ml. Autoclave and store at RT. 5. 10% SDS Dissolve 10g SDS in 100ml autoclaved distilled water. Store at RT.

Working solutions:
1. High TE (pH 8.0), 100ml 100mM Tris 10ml (1M stock) 40mM EDTA 8ml (0.5M stock) Make the final volume up to 100 ml with autoclaved ddw. Lysis buffer (pH 8.0), 100ml 10mM Tris 1ml (1M stock) 1 mM EDTA 200 l (0.5M Stock) 0.4M NaCl 40 ml (1M stock) Make the final volume up to 100 ml with autoclaved ddw Incubation buffer, 100ml 10mM Tris 1ml (1M stock) 1mM EDTA 200 l (0.5 M stock) 0.4M NaCl 40ml (1M stock) 1% SDS 10ml (10% stock) Proteinase K 10 mg/ml Dissolve 10mg of proteinase K in 1 ml of ddw and store in aliquots of 50 l at -200C.

2.

3.

4.

Procedure
Collection of blood Take 1 ml of fresh blood in a tube containing 200 l of ACD solution Composition of ACD solution (Acid citrate Dextrose solution) Citric acid : 0.48g Sodium citrate: 1.32g Glucose : 1.47g Dissolve it in 100 ml of ddw. Autoclave and store at 40C. Extraction of DNA 1. Centrifuge at 10,000 rpm for 20 min at 40C. 2. Decant the supernatant. Add 10 ml of high TE and suspend the cells properly. Centrifuge at 10,000 rpm for 10 min at 40C. 3. Discard high TE. Repeat steps of washing with TE. 4. Add 10 ml of incubation buffer to the pellet. Suspend the pellet completely and add proteinase K to the final concentration of 200 g/ml. 5. Incubate at 370C O/N. 6. Add equal volume of tris-saturated phenol. Shake gently by inverting. Add equal vol. of chloroform: isoamyl alcohol (24:1) in each tube. Again mix by inverting. 7. Centrifuge at 10,000 rpm for 10 min at 200C. 8. Take the aqueous layer in a fresh tube. 9. Add equal volume of chloroform: isoamayl alcohol. Mix gently by inverting. 10. Centrifuge at 10,000 rpm for 20 min at 200C. 11. Take supernatant in fresh tubes. Add 1/10th volume of 3M sodium acetate (pH 5.2) and 2.5 vol. of cold absolute alcohol. 12. Mix gently but thoroughly and keep tubes at -200C O/N. 13. Centrifuge at 10,000 rpm for 10 min at 40C. 14. Carefully discard supernatant. 15. Wash the pellet in 70% ethanol. 16. After air drying the pellet (not over drying), dissolve it in minimum vol. of TE (pH 8.0). 17. Store at 40C.

Mini preparation :
0.5 ml blood Spin at 10,000 rpm/20 min/40C .Decant the supernatant .Suspend the pellet in 1.0 ml of high T.E .Centrifuge and decant sup

.Wash again the pellet with high TE

Suspend the pellet in 0.5ml of incubation buffer and proteinase K to the final concentration Concentration of 200 g/ml Incubate at 370C O/N

.Add 1.5 ml of lysis buffer in each tube. Mix by inverting the tubes gently (Add equal vol. of phenol: chloroform: isoamyl alcohol. (25: 24:1 .Mix gently by inverting Centrifuge at 10,000 rpm/10 min/200C

Take aquous phase in a fresh tube .(Add equal vol. of chloroform: isoamyl (24:1 .Mix gently by inverting. Centifuge at 10,000 rpm/10 min/40C Take the aquous phase in fresh tube & add 1/10th vol. of 3M Na acetate (pH 5.2) and .2.5 vol of chilled ethanol .Slowly mix thoroughly until DNA is precipitated

.Keep at -200C O/N .Centrifuge 10,000 rpm/40C/10 min

Wash the DNA with cold 75% ethanol. Air dry DNA. Dissolve in minimum amount of TE.

OBSERVATION: Table: Genomic DNA isolated from human whole blood. Amount of OD at OD at Ratio blood 260nm 280nm OD260/OD280 Yield (g)

Total number of lymhocytes used for genomic DNA isolation= Amount of DNA in lymphocytes = Theoretical yield of DNA = Actual yield of DNA =

% efficiency of DNA isolation = Actual yield Theoretical yield

x 100

Paste the photograph of gel showing the genomic DNA

EXPERIMENT NO. 6. ISOLATION OF BACTRERIAL DNA

OBJECTIVE : Isolation of high molecular weight genomic DNA from bacteria.

PRINCIPLE : Preparation of total cell DNA from bacteria consists of following four steps : (1) growth of bacterial cells : The bacterial cells are multiplied in synthetic or undefined liquid medium. E. coli cells , for example, are grown in Luria Bertani (LB) medium. Bacterial cells are separated by centrifugation and resuspended in to a volume of 1 % of the initial volume or less. (2) Rupture/lysis of cells to obtain cell extract: Cell extract is obtained either by rupturing them mechanically or by lysing them chemically. All bacterial cells are surrounded by plasma membrane which itself is enclosed in rigid cell wall. Mechanical lysis involves crushing the bacterial mass in pestle and mortar in presence of liquid Nitrogen. Chemical lysis is most commonly used method; it employs lysozyme, EDTA or a combination of both to lyse E. coli. and related organisms. Lysozyme digests the polymeric compounds that impart the rigidity to cell wall. EDTA , on the other hand , chelates Mg2+ ions which are responsible for maintenance of cell envelope integrity. In case bacterial cells do not lyse following lysozyme or EDTA treatment, a detergent like SDS is also added. Detergent solubilizes the lipid molecules of cell membrane and therefore disrupts it completely. Sometimes a combination of mechanical and chemical lysis is also employed for bacterial celllysis. Following cell lysis, cell debris is removed by centrifugation. (3) Purification of DNA: The genomic DNA is purified by treating it with phenol, chloroform mixture that removes the protein. In case it has heavy load of proteins, it is treated with proteinase K and impurity of RNA is removed by treatment with RNase. After that phenol chloroform treatment is done to purify DNA solution. Alternatively, it can also be purified by using silica/ glass beads. (4) Concentration of DNA : DNA can be precipitated by treatment with isopropanol/ethanol. Upon its treatment , if DNA concentration is high , DNA can be seen at interface of alcohol and DNA solution. At this stage , it can be collected by using a glass rod. This is known as spooling of DNA. If DNA concentration is low , it can be precipitated by keeping it at 200 C. After precipitation of DNA , it is sedimented and dissolved in suitable buffer such as TE buffer and afterwards it is quantitated.

REQUIREMENTS : Tris-base, EDTA Na2, NaCl, Liq N2, Proteinase K, SDS, Trissaturated phenol, chloroform, Isoamyl alcohol, absolute alcohol, Sodium acetate

Stock solutions
1. 1M Tris-Cl buffer (pH 8.0), 100ml Dissolve 12.114g of Tris-base in 80 ml water, adjust the pH to 8.0 with 6N HCl and finally make the vol. 100 ml. Autoclave and store at RT. 2. 0.5M EDTA (pH 8.0), 100ml Dissolve 18.612 g of EDTA Na2 in 80 ml of water (add 10N NaOH to adjust the pH 8.0 so that EDTA dissolves). Make the final vol. to 100 ml. Autoclave and keep at RT.

3. 10N NaOH, 50 ml Dissolve 20 g NaOH in 30 ml water and finally make the volume upto 50 ml. Autoclave and keep the solution at RT. 4. 1M NaCl , 100 ml Dissolve 5.85 g of NaCl in 80 ml of ddw and finally make the vol. upto 100 ml. Autoclave and store at RT. 5. 10% SDS, 50 ml Autoclave 50 ml ddw. Dissolve 5 g of SDS in 50 ml. Keep it at 37 0C or at 600C water bath for complete dissolution.

Working solutions
1. Saline EDTA solution 50 ml 100 mM NaCl : 5 ml (1 M NaCl) 1 mM EDTA : 50 l (0.5 M EDTA) Make the volume upto 50 ml with autoclaved ddw. 2. Proteinase K (20 mg/ml) Dissolve 20 mg of proteinase K in 1ml of sterilized H2O. Resterilize by filteration and store at -200C in aliquots. 3. 3M Sodium acetate (pH 7.0), 25 ml Dissolve 10.20 g of Na acetate in 15 ml of ddw. Adjust the pH to 7.0 with dilute acetic acid. Finally make the volume upto 25 ml with ddw. Autoclave and store at 40C. 4. 70% Alcohol, 100 ml 5. TE (pH 8.0), 20 ml 10 mM Tris-Cl 1 mM EDTA : : 200 l (1M Tris-Cl) 40 l (0.5M EDTA)

PROCEDURE :
1. Take 0.5 g of harvested cells and wash them with saline-EDTA solution. 2. Freeze the pellet by liq-N2. The frozen pellet is then crushed in a precooled, autoclaved pestle and mortar in the presence of liq. N2 and incinerated cover slips. 3. Cells were crushed for about 15 min till the powder like consistency is reached. 4. The fine powder was transferred to a 50 ml sterile Oakridge tube. 5. The mortar was allowed to warm to RT and then 10 ml of saline-EDTA was used to wash any residual cells out of mortar into the tube. 6. Egg-white lysozyme is added to a final concentration of 200 g/ml and the tube was incubated at 370C with gentle swirling for 1 h.

7. Add proteinase K to the final conc. of 250 gm/ml and incubate at 60-650C for 15 min. 8. Add SDS to the final conc. of 3.5% (v/v) and further incubate the tube at 60-65 0C for additional 15 min with occasional gentle swirling. 9. Cool the tube to RT and add equal vol. of phenol (Tris saturated, pH 7.0). shake gently till an emulsion is formed. 10. Centrifuged at 5,000 rpm for 15 min at 100C. Remove the top aq. layer with cut tips, and transfer to a fresh Oakridge tube. 11. Repeat this step till a clear interface is observed. 12. Repeat the same treatment with chloroform: isoamyl alcohol (24:1) twice. 13. To the final aq. phase add 3M Na acetate (pH 7.0) to a final concentration 0.3 M and 2 volumes of chilled ethanol. 14. Mix the two phases with a sterile tip. The DNA starts spooling around the tip. 15. Take out the tip with the adhered DNA on it and dipped in 70% ethanol. 16. The DNA is air dried and dissolved in TE. This DNA is left at 4 0C until it dissolves completely.

OBSERVATION: Table: Genomic DNA isolated from bacteria. Amount of OD at OD at Ratio bacterial 260nm 280nm OD260/OD280 cells

Yield (g)

O.D. 600 of bacterial culture = Bacterial cell number/ml used for DNA isolation =

Total number of cells used for DNA isolation =

Theoretical yield of DNA =

Actual yield of DNA =

% efficiency of DNA isolation = Actual yield Theoretical yield

x 100

Paste the photograph of gel showing the genomic DNA

Safety precautions:
1. Use gloves and goggles when handling phenol which causes burns when in contact with animal tissue. 2. Handle pathogenic bacteria carefully, wear mask. 3. After cell harvesting discard supernatant in disinfectant. 4. Avoid breathing or contact with chloroform.

EXPERIMENT NO. 7. EXTRACTION OF LEAF DNA OBJECTIVE : To isolate high molecular weight genomic DNA from leaf.
PRINCIPLE : The principle is essentially similar to that for bacterial genomic DNA except that various steps differ considerably. Cells are usually ruptured by mechanical force following several methods. The most commonly used method is grinding the plant tissues in mortar and pestle in the presence of liquid Nitrogen. Liquid Nitrogen freezes the tissue rapidly and allows fine grinding in mortar and pestle. Sometimes plant tissue is ground by using glass , steel or tungsten carbide beads in pestle and mortar. The disrupted plant cells are lysed and extracted with a suitable buffer which contains a detergent such as CTAB(cetyl trimethyl ammonium bromide ). Heat treatment is often given at this stage to completely lyse the plant cells. And after that it is extracted once with chloroform which dissolves most of the impurities like protein , carbohydrate , cell debris etc. Nucleic acids come in aqueous phase which is then separated by centrifugation. DNA can be precipitated by addition of ethanol/isopropanol and can be spooled out using a glass rod. Spooled DNA can be taken in to fresh tube and then it is dissolved in TE buffer and quantitated.

Requirements : CTAB, (N-Cetyl N, N, N Trimethyl Ammonium Bromide). Trisbuffer, NaCl, EDTA Na2, - mercaptoethanol (BME), Isopropanol, Ethanol, chloroform, Isoamyl alcohol.

Stock solutions: 1 Tris-Cl Buffer (pH 8.0), 100 ml

Dissolve 12.114 g of Tris-base in 80 ml of ddw. Adjust the pH to 8.0 with 6N HCl. Now make the vol. upto 100 ml by ddw. Autoclave and store at 40C. 2. 0.5M EDTA (pH8.0), 50 ml. Dissolve 9.3 g of EDTA Na2 in 30 ml of water (add 10N NaOH to make the pH8.0), make the final vol. upto 50 ml. Autoclave and store at 40C.

Working solutions
1. Extraction buffer, 2% (w/v) CTAB : 100 mM Tris-Cl : 1.4 M NaCl : 20 mM EDTA : 0.2% Beta mercaptoethanol 25 ml 0.5 g 2.5 ml (1M stock) 2.0475 g 1ml (0.5M stock) : 50 l

2.

TE buffer (pH 8.0), 10 mM Tris-Cl : 1 mM EDTA :

25 ml 250 l (1M stock) 50 l (0.5M stock)

PROCEDURE:
1. Wash the leaf material with autoclaved ddw and then with absolute alcohol. 2. Grind 0.5 g leaf material in liq. N2 to fine powder using pre-chilled pestle and mortar. 3. Transfer the powder to 15 ml polypropylene tubes containing 3.0 ml of prewarmed extraction buffer. Use spatula to dispense the material completely. 4. Incubate samples at 600C for 30 min with occasional mixing by gentle swirling. 5. Add 3 ml chloroform: isoamyl alcohol (24:1) and mix by inversion to emulsify. 6. Spin at 15,000 rpm at RT for 10 minutes. 7. Remove the aqeous. phase with a wide bore pipette, transfer to a clean tube, add double volume of isopropanol and mix by quick gentle inversion. 8. Spool DNA using a bent pasteur pipette, transfer to another tube. OR spin at 10,000 rpm, for 10 min to precipitate DNA. 9. Wash the DNA pellet in 70% ethanol for 20 minutes. 10. Dry the pellet and dissolve in 200 l TE buffer. Store at -200C. 11. Quantitate the sample and check the quality by agarose gel electrophoresis.

OBSERATION :
Table: Genomic DNA isolated from bacteria. Amount of OD at 260nm OD at 280nm bacterial cells Ratio OD260/OD280 Yield (g)

Weight of leaf tissue taken = Approximate number of plant cells taken for genomic DNA isolation = Theoretical yield of DNA = Actual yield of DNA (obtained after extraction) = % efficiency/recovery of DNA = Actual yield x 100 Theoretical yield Paste the photograph of gel showing the plant genomic DNA.

Safety quidelines: 1. It is very important to prechill the mortar with ice to prevent the tissue from thawing out.Plant tissues are rich in nuclease activity so the frozen powder should not be thawed until it is dispersed in warm extraction buffer. 2. If leaf tissues are rich in phenolic compounds, a small amount of insoluble PVPP (100 mg/g of tissue) can be added to the frozen tissue during grinding. PVPP binds polyphenols and prevents them from copurifing with DNA. 3. The DNA solutions should be handled gently in all steps in order to avoid shearing of DNA.

EXPERIMENT NO. 8. EXTRACTION OF WHEAT SEED DNA

OBJECTIVE : To isolate high molecular weight genomic DNA from wheat

seeds.

REQUIREMENTS : Tris base, EDTA Na2, SOS, NaCl, Potassium Acetate,

Glacial acetic acid, isoproponol, Phenol, Chloroform, isoamyl alcohol, Absolute alcohol.

Stocks Solutions :
1. 1M Tris-Cl buffer (pH 8.0), 100ml Dissolve 12.114 g Tris-base in 80 ml ddw. Adjust the pH to 8.0 by 6 N HCl. Now make the volume upto 100 ml with ddw. Autoclave and store at 40C. 2. 0.5M EDTA (pH 8.0), 50 ml Dissolve 9.3 g in 30 ml of ddw (add 10 N NaOH to make the pH 8.0). Make the final vol to 50 ml. Autoclave and store at 40C. 3. 10N NaoH, 50 ml Dissolve 20 g of NaOH in 30 ml autoclaved ddw. Make the volume upto 50 ml. Store in a plastic bottle at RT. 4. 10% SDS, 50 ml. Autoclave 50 ml ddw in a bottle. Add 5g SDS to it. Keep it at 37 0C or 600C water bath for complete dissolution. Store at RT. 5. 5M NaCl, 50 ml Dissolve 14.6 g NaCl in 30 ml of ddw. Now make the final vol upto 50 ml. Autoclave and store at RT.

Working solutions
1. DNA extraction buffer, 25 ml 0.1M Tris-Cl buffer : 2.5 ml (1 M stock) 0.05 M EDTA : 2.5 ml (0.5M stock) 1% SDS : 2.5 ml (10% SDS) 50 mM NaCl : 250 l (5M stock) Now make up the final vol. to 25 ml with ddw. 2. 5 M potassium Acetate (pH 5.4), 50 ml Dissolve 24.8 g potassium acetate in 30 ml of ddw. Adjust the pH to 5.4 with glacial acetic acid. Make the volume to 50 ml with ddw. Autoclave and store at RT. 3. Isopropanol : keep at 00C. 4. Phenol : chloroform : isoamyl alcohol (25:24:1), 25ml 5. 70% ethanol, 10 ml

PROCEDURE
1. 1 g of seeds were first washed with ddw and then with ethanol. 2. Crush them in pre-cooled, sterilized pestle mortar into a dry powder. 3. Transfer the powder in a autoclaved Oakridge tube. Add 10 ml of extraction buffer and leave at 650C for 30 min. 4. Add 4.5 ml of 5M potassium acetate (pH 5.4) and mix thoroughly. 5. Leave the solution in ice for 30 min.

6. Centrifuge at 10,000 rpm for 30 min at 40C. 7. Supernatant was transferred to a new tube and same volume of chilled isopropanol was added and kept O/N at 00C. 8. Centrifuge at 10,000 rpm for 15 min at 40C. 9. Air dry the pellet and dissolve in minimum volume of phenol:chloroform : isoamyl alcohol and mix the tube gently. 10. Centrifuge at 12,000 rpm for 10 min at RT. 11. Wash the pellet with 70% ethanol. Air dry the pellet and dissolve in required amount of TE buffer.

OBSERVATION: Table: Genomic DNA isolated from wheat seeds Amount of OD at OD at Ratio seeds 260nm 280nm OD260/OD280

Yield (g)

EXPERIMENT NO. 9. Genomic DNA extraction from fungus Objective : Isolation of total high molecular weight genomic DNA from fungus
(Rhizoctonia solanii) Principle : CTAB method is used for isolation of genomic DNA from fungus CTAB precipitates carbohydrates at high temperature and high salt concentration, and it precipitates the nucleic acids at low salt concentrations, and low temperature.

Reagents used A) Stocks prepared

1. 1M Tris-Cl buffer (pH 8.0),100 ml Dissolve 12.114 g of Tris-base in 80 ml water, adjust the pH to 8.0 by 6 N HCl and finally make the volume 100 ml. Autoclave and store at RT. 2. 0.5 M EDTA (pH8.0),100 ml. . Dissolve 18.612 g of EDTA Na2 in 80 ml of water (add 10N NaOH to make the pH 8.0 so that EDTA dissolves completely) and make the final volume to 100 ml. Autoclave and keep at RT. 3. 10 N NaOH, 50 ml Dissolve 20 g NaOH in 30 ml water and finally make the volume upto 50 ml. Autoclave and keep the solution at RT. 4. 1 M NaCl ,100 ml Dissolve 5.85g of NaCl in 80 ml water and finally the volume was made upto 100 ml. Autoclave and store at RT.

B) Working solutions
1. DNA extraction buffer, 25 ml Tris-Cl (50 mM) : 1.25 ml (1M stock) EDTA (100 mM) : 5 ml (0.5M stock) Nacl (150 mM) : 3.75 ml (1 M stock) Above components were added to 20 ml of deionised water. pH was adjusted to 8.0 with 6N HCl and finally the volume was made upto 25 ml. Autoclave and stored at 40C. 70% ethanol 100 ml Absolute ethyl alcohol 70 ml Deionised water 30 ml Store at 40C 10% (w/v) SDS, 100 ml Dissolve 10 g SDS in 100 ml of deionised water by keeping it at 600C water bath or incubator. Store at RT. CTAB solution , 10 ml CTAB (10%) 1g NaCl (0.7 M) 7 ml (1M stock) Make the final volume 10 ml with autoclaved ddw. 5. 5 M NaCl, 100 ml. Dissolve 29 g of NaCl in 80 ml of deionised water. make the vol. upto 100 ml. Autoclave and store at R.T. 3 M Sodium Acetate (pH 5.2),100 ml

2.

3. 4.

6.

Dissolve 24.6 g of sodium acetate in 40 ml deionized water with continuous stirring. Adjust the pH to 5.2 with glacial acetic acid. Make the final vol. 100 ml to. Autoclave and store at 40 C. 6. Chloroform: isoamyl alcohol (24:1), 50 ml. Chloroform 48 ml isoamyl alcohol 2 ml Mix and store at 40C in dark bottle. 7. Isopropanol 8. TE buffer, 50 ml Tris-Cl (10 mM) : 500 l (1M stock) EDTA (1 mM) : 100 l (0.5M stock) Procedure 1. 0.2 g of lyophilized mycelia was grounded in a pestle mortar along with incinerated cover slips into a very fine powder. 2. Suspend the powder in 10 ml of DNA extractions buffer. 3. Add 1 ml of 10% SDS after proper shaking. 4. The mixture was shaken gently at 370 C for 1h. 5. 1.5 ml of 5 M NaCl was added and mixed thoroughly but gently. Add 1.25 ml of CTAB/NaCl solution, again mix thoroughly and incubate at 650C for 20 min in shaking at 60 rev/min. 6. DNA is extracted by adding equal volume of chloroform: isoamyl alcohol (24:1) and mix thoroughly and gently. Centrifuge at 10,000 rpm for 12 min at 100C. 7. Remove viscous aqueous supernatant to a fresh tube and precipitate with 0.6 vol of ice cold isopropanol and 0.1 volume sodium acetate and leave O/N at -20oC. This mixture was centrifuged at 10,000 rpm for 10 min at 100C. Pellet was washed with 70% ethanol and dried completely. Pellet was then dissolved in minimum amount of TE buffer. OBSERVATION:

Table: Genomic DNA isolated from fungus Amount of OD at OD at Ratio fungus cells 260nm 280nm OD260/OD280

Yield (g)

EXERCISE NO. 10.

OBJECTIVE: Purification of DNA by binding and elution from glass or silica particles INTRODUCTION: This technique is widely used to isolate DNA fragment of interest from any grade of agarose. Impurities like proteins and RNAs are removed. The technique is also employed to obtain sequencing grade DNA and purification of DNA between enzymatic reactions like restriction digestion, dephosphorylation with CIP, ligations or transformations. Any residual phenol, chloroform, unincorporated nucleotides from reaction mixtures, primers from PCR products or any excess linkers after ligation are removed. PRINCIPLE: In an environment of high salt and neutral or low pH, DNA binds avidly to glass, silica gel or diatomaceous earth. This phenomenon can be exploited to purify DNA from solutions containing impurities such as agarose. Typically, a slice of agarose containing the DNA of interest is "melted" by incubation in a solution containing chaotropic salt (e.g. sodium iodide) at a pH of 7.5 or less. Glass powder or silica gel is then added and the suspension is mixed to allow adsorption of DNA. The particles can then be recovered from the original liquid and washed by centrifugation and resuspension in high-saltethanol buffer. Finally, the pellet is resuspended in a solution with low or no salt at basic pH, the free particles pelleted by another centrifugation, and the DNA-containing supernate recovered. The glass powder provided in the kit binds to the DNA greater than 500 bp without binding to DNA contaminants. MATERIALS PROVIDED: 1. pUC/ Taq1 digest (DNA) 2. Silica 3. Wash buffer 4. 6 M NaI solution 5. Agarose 6. 50 X TAE 7. 1X TE 8. Gel loading buffer 9. Staining dye 6X PROCEDURE: 1. Prepare 1% agarose gel. 2. Load 25 l (5 g) of DNA

3. Electrophorese the sample at 50 V till the second dye (blue dye) has run of the distance. 4. Excise precisely with a sharp blade the lane in which DNA has run. Take care not to dislodge the rest of the gel while excising. Do not cut rest of the wells. Place the excised lane in a tray and follow the staining and destaining protocol. 5. Staining the gel: Place the gel block in a small tray and pour the staining dye on it. Make sure this is completely immersed and shake the tray slowly. Staining takes approx. 1h. Shake the tray every 5-10 min during this period or else use rocker. 6. Remove the staining dye in a container (dye can be reused). Destain the gel using tap water by giving frequent changes till the DNA is visible as a dark blue band against a light blue background. Gel can be kept for destaining O/N. 7. Disconnect the cords, keep the rest of the gel submerged in the running buffer at 40C. 8. Upon destaining three blue bands corresponding to 3 fragments of DNA will be visible as follows: 9. Cut each band precisely and place separately in 3 different pre weighed 1.5 ml tubes. 10. Weigh the gel piece (usually <0.4 g) and add 2.5 volumes of sodium iodide solution. 11. Solubilize the gel in a 1.5 ml tube at 450C-500C by placing in water bath or dry bath for 5 min. 12. After 5 min tap the tube to mix the contents and incubate for further 5 min to ensure complete solubilization. 13. Vortex the silica solution till it is uniform in suspension. 14. Add 15 l of silica solution to the solubilized sample. Leave it at RT for 10-15 min with intermittent mixing. This allows adsorption of DNA molecules to the silica.

15. Spin at 8,000 rpm for 1-2 min and discard the clear supernatant. The pellet consists of DNA bound to silica. 16. Add 200 l of wash buffer, vortex and spin at 8,000 rpm for 1-2 min and discard the supernatant. Repeat this washing step twice. 17. Remove carefully the traces of wash buffer after the second wash. Keep the tube open in 370C incubator to ensure complete drying of the pellet. 18. To elute DNA add 15 l 1X TE buffer to the pellet and mix by mild vortexing. Incubate at 45-550C for 10 min. 19. Spin at 8000 rpm for 1-2 min and collect the supernatant in a fresh tube. 20. A second elution with 15 l of 1X TE buffer will ensure total recovery of DNA. 21. Pool supernatants which will be about 25 l and spin at 8,000 rpm for 2 min to remove traces of silica from the sample. 22. Remove the supernatant to a fresh tube. Add 5 l of gel loading buffer with the help of 10 l capillary. 23. Load individual samples (3 bands of digest sample) along with pUC/Taq digest which serves as control in different wells of the gel made previously. Follow the electrophoresis, staining and destaining as mentioned earlier OBSERVATION: Paste the photograph of the gel showing purified and unpurified samples.

Quantitate the DNA after purification and find out if impurities of RNA or protein have gone. OD260 of unpurified sample = OD260 of purified sample = % improvement in yield =

QUESTIONS: 1. What is the principle involved while purifying DNA by silica or glass beads? 2. Why there is need to do DNA purification ? 3. How will you purify two DNA samples which have an OD 260/OD280 ratio of 1.3 and 2.2?

EXPERIMENT NO. 11. SATURATION OF PHENOL OBJECTIVE : To saturate or equilibrate the phenol for DNA purification PRINCIPLE : Crystalline phenol is distilled at 1600C to remove oxidation products ,
such as quinines, that cause the breakdown of phosphodiester bonds or cause crosslinking of RNA or DNA. Before use , phenol must be equilibrated to a pH of > 7.8 because DNA partitions in to the organic phase at acid pH. Hydroxyquinoline is added to the phenol. This is an antioxidant, a partial inhibitor of RNase, a weak chelator of metal ions. Its yellow colour provides a convenient way to identify the organic phase.

REQUIREMENTS:
Crystalline phenol, hydroxyquinoline, Tris-buffer, Separating funnel

STOCK SOLUTIONS:
1M Tris-Cl buffer (pH 8.0), 1000ml Dissolve 121.14g of Tris-base in 800 ml of ddw. The pH was adjusted to the desired value by adding conc. HCl approx. 40 ml. Adjust the volume to 1 litre with ddw.

Working solutions:
1. 0.5M Tris-Cl (pH 8.0) 2. 0.1M Tris-Cl (pH 8.0)

Procedure:
1. 2. 3. 4. 5. 6. 7. Distill the crystalline phenol at 1600C to remove oxidation products. It is melted at water bath of 680C. Add hydroxyquinoline to a final concentration of 0.1%. Now add an equal volume of 0.5 M Tris-Cl pH 8.0. Shake and mix both the phases well in a separating funnel and allow the two layers to separate. Now take the upper aqueous layer in separate flasks. Now repeat this process with 0.1 M Tris-Cl pH 8.0 till the pH of the phenol reaches between 7.0-7.5. After the phenol is equilibrated, 0.1 volumes of 0.1 M Tris-Cl pH 8.0 is added to it. Finally it is stored at 40C in a light resistant bottle.

Review Questions:
1. Why is phenol distillation required? 2. How will you saturate phenol with Tris ? 3. Why is phenol required to be saturated with phenol before itsuse for DNA isolation?

EXPERIMENT NO. 13. PURIFICATION OF DNA BY PHENOL CHLOROFORM EXTRACTION PROCEDURE OBJECTIVE: To purify the isolated high molecular weight genomic DNA. PRINCIPLE: Major contaminants in crude DNA preparations are RNA, protein and
polysaccharides. Inclusion of CTAB in DNA extraction buffer helps elimination of polysaccharides from DNA preparations to a large extent. The RNA is removed by treating the samples with RNase. Proteins including RNase can be removed by treatment with proteinase K. Extraction with phenol: chloroform following RNase or proteinase treatment is employed for eliminating RNA and most of proteins. Given below is the protocol of DNA purification. Upon addition of mixture of phenol , chloroform and isoamyl alcohol in 25:24:1 ratio , they precipitate the proteins but leave the nucleic acids in aqueous solution. The result is that if the DNA solution treated with RNase, proteinase is mixed with phenol,chloroform mixture and centrifuged , precipitated protein molecules which include RNase, proteinase also are left as white coagulated mass at the interface between the aqueous and organic layers. The aqueous solution of nucleic acids can then be removed with a pipette and can be precipitated by isopropanol/ethanol. In the presence of salt ( monovalent cations such as Na+ ) and at a temperature of 200C or less , alcohol precipitates the nucleic acids such as DNA and the precipitate can be collected by centrifugation.

REQUIREMENTS: RNase, Tris-buffer, NaCl Phenol, chloroform, isoamyl alcohol,

sodium acetate, absolute alcohol.

Stock Solutions:
1. 1M Tris-Cl buffer, pH 8.0 2. 0.5M EDTA Na2, pH 8.0 3. 1M NaCl

Working solution:
1. RNase buffer, 10 ml 10 mM Tris-Cl : 200 l (1M Tris-Cl, pH 8.0) 15mM NaCl : : 150 l (1M NaCl) Make the volume upto 10ml with autoclaved ddw. 2. RNase (10 mg/ml) Dissolve 10mg of RNase in 1ml of RNase buffer. Heat the tube in boiling water bath for 15 min to denature contaminating DNase. Cool slowly at RT. Store in aliquots of 100 l at -200C. 3. Phenol: Chloroform: isoamyl alcohol (25: 24 : 1) 4. Chloroform : isoamyl alcohol (24:1) 5. 3M Sodium acetate (pH 4.8) : 50 ml

Dissolve 12.3 of sodium acetate in 30ml of ddw. Adjust the pH 4.8 by acetic acid. Make the volume upto 50ml.. Autoclave and store at 40C. 6. TE Buffer

PROCEDURE :
1. Add RNase to the DNA sample (50 g/ml) and incubate at 370C for 1h. 2. Add proteinase to the DNA sample ( 250 g/ml) and incubate at 370C for 1 h. 3. Add equal volume of phenol: chloroform: isoamyl alcohol and mix gently. 4. Centrifuge at 10,000 rpm for 2 min at room temp. Transfer the aqeous phase to a fresh tube. 5. Extract twice with equal volume of chloroform: isoamyl alcohol (24:1). Centrifuge and take the aqeous phase in a fresh tube. 6. Add 0.1 volume of 3 M sodium acetate (pH 4.8) and mix properly. 7. Add 2.5 volume of absolute ethanol, mix gently and allow the DNA to precipitate at -200C O/N. 8. Pellet the DNA by centrifugation at 10,000 rpm for 5 min. 9. Decant supernatant carefully, wash the pellet with cold 70% ethanol, air dry and dissolve DNA in 50-100 l TE buffer.

OBSERVATION: OD of DNA sample before RNase and proteinase treatment= OD of DNA sample after RNase and proteinase treatment= % improvement in yield = 3. Check the quality of DNA by agarose gel electrophoresis by running the samples before and after RNase or proteinase treatment. Paste the photograph of gel.

EXPERIMENT NO. 13. QUANTITATION OF DNA OBJECTIVE: Quantitation of DNA by spectrophotometric method. PRINCIPLE: Reliable measurements of DNA concentration is important for many
applications in molecular biology like complete digestion of DNA by restriction enzymes and amplification of target DNA by polymerase chain reaction. DNA quantitation is generally carried out mainly by two methods. 1. Spectrophotometric: DNA absorb UV light due to conjugated aromatic nature of bases. Maximum absorption of UV light by the bases coocurs at the wavelength of 260nm which is distinct from the property of proteins which absorb maximally at 280nm. Therefore, the simplest method of quantitation of DNA is reading the absorbance at 260 nm at which an OD260 of 1 in a 1 cm path length is equal to 50 g/ml for doublestranded DNA, 40 g/ml for single-stranded DNA and RNA and 20-33 g/ml for oligonucleotides. An absorbance ratio of 260 nm and 280 nm gives an estimate of the purity of the solution. Pure DNA and RNA solutions have OD260/OD280 values of 1.8 and 2.0, respectively. Therefore a ratio higher than 1.8 indicates RNA contamination and a ratio lower than 1.8 indicates protein contamination. 2. Ethidium bromide fluorescence: The amount of DNA is a solution is proportional to the fluorescence emitted by ethidium bromide in that solution. Dilutions of an unknown DNA in the presence of 2 g/ml ethidium bromide are compared to dilutions of a known amount of a standard DNA solutions spotted on an agarose gel or Saran Wrap or electrophoresed in an agarose gel. By comparing the intensity of fluorescence , concentration of unknown can be found out.

REQUIREMENTS: TE buffer, quartz cuvette, Spectrophotometer, DNA. PROCEDURE:

1. Take 3 ml TE buffer in cuvette and calibrate spectrophotometer at 260 nm as well as at 280 nm. 2. Now take 5 l, 10 l, 15 l, 20 l DNA + 3 ml TE and mix properly and read the O.D at both 260 and 280 nm. 3. Estimate the DNA concentration employing the following formula: A260 50 dilution factor Amount of DNA ( g/ l) = 1000 4. Judge the quality of DNA from the ratio of the OD values recorded at 260 and 280 nm. The A260/A280 ratio around 1.8 (1.75-1.85) indicates best quality DNA.

OBSERVATION TABLE:

DNA Sample

OD at 260nm

OD at 280 nm

Ratio

DNA concentation ( g/ l)

Review Questions : 1. What is the need to quantitate the DNA ? 2. How will you quantitate DNA spectrophotometrically? 3. How will you find out if an unknown sample is having RNA or protein contamination ? What is the principle involved in it ? 4. How DNA can be quantitated by agarose gel electrophoresis ?

EXPERIMENT NO. 14. PCR (POLYMERASE CHAIN REACTION ) OBJECTIVE : To introduce the students about the basic principle underlying the powerful technique of polymerase chain reaction. INTRODUCTION : The development of PCR (polymerase chain reaction) technique has revolutionized the field of Biotechnology. Beginning with single molecule of DNA , PCR can generate million of copies of that molecule in few hours. Kary Mullis discovered this technique in 1983 and he received Nobel prize for this discovery in 1993. This technique plays an important role in all scientific areas such as in basic research e.g. sequence analysis, targeted mutagenesis and cloning ; in molecular diagnostics e.g. identification of bacterial , fungal, viral or protozoan infections ; in forenscic science e.g. identification of criminals ; in establishing familial relationships etc. PRINCIPLE: The technique involves repeated rounds of in vitro DNA synthesis by a heatstable enzyme, known as Taq DNA polymerase which is isolated from a bacteria called Thermus aquaticus. To perform a PCR reaction, PCR reaction mixture is prepared for which a small quantity of the target DNA is added to an eppendorf with a buffer containing Taq DNA polymerase, oligonucleotide primers, the four deoxynucleotide of DNA (dNTPs), and the cofactor MgCl2 are mixed. Under most conditions, DNA is double-stranded, consisting of two such nucleotide chains that wind around each other as the double helix. Primers are single-stranded and consist of a string of nucleotides in a specific order that will, under the right conditions, bind to a specific complementary sequence of nucleotides in another piece of single-stranded DNA. For PCR, primers must have complementry nucleotide sequences on either side of the piece of DNA of interest. The flanking sequences can be synthesized in the laboratory on DNA synthesiser, or purchased from commercial suppliers. The PCR mixture is taken through replication cycles consisting of: 1. Denaturation: at 94-96 degrees C, the DNA is denatured into single strands 2. Annealing: at 50-65 degrees C, two primers i.e. forward and reverse primers anneal to their complementary sequences on either side of the target sequence 3. Extension at 72 degrees C, the polymerase binds and extends a complementary DNA strand from each primer. Steps from 1-3 comprise one cycle. As amplification proceeds, the DNA sequence between the primers doubles after each cycle. Thus, the amount of amplified product will be 2n copies starting from single molecule after n no. of cycles. One of the major problem with PCR is contamination of the sample with extraneous genetic material that could generate numerous copies of undesired DNA resulting in faulty interpretation. After amplification, the PCR products are loaded on an agarose gel and electrophoresed. Since PCR amplifications can generate microgram quantities of product, amplified fragments can be visualized easily following staining with ethidium bromide. As the amplification is selective - only the DNA sequence between the primers is amplified exponentially. The rest of the DNA in the genome is not amplified and remains invisible in the gel.

Figure : Different steps of a PCR cycle.

FACTORS AFFECTING AMPLIFICATION 1. Sample volume and microfuge tube Most amplifications are performed at 20, 50 or 100 l volume in 0.2 or 0.5ml microfuge tubes. Large volumes do not allow adequate thermal equilibrium of the reaction mixture. 2. Template DNA Typically nanogram amounts of cloned template, upto g amount of genomic DNA or 20,000 target copies are chosen to start optimization trails. Higher amounts of template DNA inhibits or results in non-specific amplification. 3. Primers They are oligonucleotides ranging from 15-30 bases. Primers designed should be such that at 3 ends, they should not contain more than two bases complimentary to each other. This can result in the formation of primer dimer. No internal secondary structure should be present. G+C content typically should be 40-60%. Optimal annealing temperatures must be determined empirically. The concentration of primers ranges between 0.1-1 M. The melting temp (Tm) of both forward and reverse primers should be same. 4. Deoxy nucleotide triphosphates Typically the final conc. of each dNTP in a standard amplification reaction mix is 200 M. It is important to keep the 4 dNTPs concentrations above the estimated Km of each dNTP (10-15 M) and balanced for best incorporation fidelity. 5. Taq DNA polymerase buffer The 10X buffer which contains 500 mM KCl, 100 mM Tris HCl (pH 9.0), 15 mM MgCl2, 0.1% (w/v) gelatin is supplied. It is advisable to carry out a titration series in small increments over the 1.5 to 4 mM MgCl2 range to determine the MgCl2 concentration producing the highest yield of a specific product. Too little free Mg will result in no amplification and too much may produce a variety of unwanted products. 6. Taq DNA polymerase Taq DNA polymerase is a 94 kDa thermostable DNA polymerase which lacks 3 to 5 exonuclease activity but has 5 to 3 exonuclease activity in addition to 5 to 3 polymerase activity. For most amplification reactions 1.5 to 2 units of enzyme are recommended as excess of it leads to non-specific amplification. 7. Thermal profiles DNA denaturation is the critical step in the DNA amplification reactions. The time specified for DNA depends on various factors like, nature of template, GC content, secondary structure etc. For most amplifications, incubation time for DNA denaturation is 30 sec-1 min at 92 to 950C, with 940C being standard choice. Primer annealing Primer annealing in most of the cases is done 37 to 550C. The specified annealing temperature is calculated empirically and is usually 50C less than the Tm of the primers used. Extreme annealing temperature may result in non specific amplification.

Primer extension Primer extension in most amplifications occur efficiently at a temp. of 720C and seldom needs optimization. Time specified for extension depends on the length of target sequence. For example for 1 kb target DNA usually 1 minute extension is recommended. MATERIAL &REAGENTS: We shall use a kit for this experiment, which is having following reagents: 1. Taq DNA polymerase: Supplied 30 units as 3 units/ l is recommended per reaction. Store at -200C or freezer compartment of fridge. 2. Deoxynucleotide triphosphate: dNTP mix is supplied as 30 l and recommended use is 3 l/reaction. This mixture has a final concentration of 2.5 mM of each dNTP and a 10 mM concentration of total mix. Store at -200C or freezer compartment of fridge. 3. Assay buffer: Supplied 100 l 10X Taq polymerase assay buffer with magnesium chloride. Composition: 100 mM Tris HCl (pH 9.0), 500 mM KCl, 15 mM MgCl2 and 0.1% gelatin. Store at -200C or freezer compartment of fridge. 4. DNA template: This is a genomic DNA purified from Serrratia marcescens of concentration 200 ng/ l. 10 l is supplied, use 1 l/ reaction. 5. Control primers: Forward primer: It is 18 bases long oligomer. Use 1 l per reaction, supplied 10 l of 100 ng/ l concentration. Reverse primer: It is 28 bases long ologmer. Use 1 l per reaction, supplied 10 l of 100 ng/ l concentration. 6. Nuclease free H2O: Supplied at 1ml, store at 40C. 7. Mineral oil: Supplied at 0.5ml, store at RT. 8. Agarose: 5g, store at RT 9. Gel loading dye: 100 l, store at 40C 10. PCR tubes 11. Contol: DNA marker 5 g 12. 50X TAE: 40ml PROCEDURE: 1. Prepare the PCR reaction mix (50 l) by adding the following reagents to a PCR tube. 10X Assay Taq Pol. Buffer + 15 mM MgCl2 5 l dNTP mix 3 l Template DNA (200 ng/ l) 1 l Forward primer (250 ng/ l) 1 l Reverse primer (250 ng/ l) 1 l Taq DNA polymerase (3 u/ l) 1 l Sterile water 38 l _____________________________________________________ Total reaction volume 50 l

Note : Add template DNA as a last component while preparing the PCR reaction mix.Depending upon number of samples to be amplified , it remains better to prepare a master mix 2. Mix the contents gently and layer the reaction mix with 50 l of mineral oil. (optional, as per the specification of PCR machine) Carry out the amplification using following reaction conditions for 30 cycles. Step Temperature Time 0 Initial denaturation 94 C 1 min Denaturation 940C 30 sec Annealing 480C 30 sec 0 Extension 72 C 1 min Final extension 720C 2 min 3. After the reaction is over, take out the reaction mix and run 10 l of the aq. layer in 1% agarose gel for 1 to 2 h at 100 volts. Run the sample along with marker and locate the amplified product by comparing with the 0.8 kb fragment of the marker. 4. Stain with ethidium bromide and visualize under UV light for 0.8 kb DNA fragment. OBSERVATION : Paste the photograph of agarose gel showing the amplified gene product.