Professional Documents
Culture Documents
Introduction
Bioluminescence is the production and emission of light by a living organism. Its name is a hybrid word, originating from the Greek bios for "living" and the Latin lumen "light". Bioluminescence is a naturally occurring form of chemiluminescence where energy is released by a chemical reaction in the form of light emission. Fireflies, anglerfish, and other creatures produce the chemicals luciferin (a pigment) and luciferase (an enzyme).
Biochemistry of Bioluminescence
Bioluminescence has several functions in different taxa: Counterillumination camouflage Mimicry to attract prey Attracting mates Distraction Repulsion of Predators Communication Illumination
Bioluminescence in Biotechnology
Bioluminescent organisms are a target for many areas of research. Luciferase systems are widely used in the field of genetic engineering as reporter genes. Luciferase systems have also been harnessed for biomedical research using bioluminescence imaging. Bioluminescence is used to determine the amount of toxic chemicals present in water.
Bioindicators
Bioindicators are microorganism which acts as indicators
of several substances usually presence of pollutant in water, land, air etc. These microorganisms can be used to make biosensors. A biosensor is a device that detects, records, and transmits information regarding a physiological change or the presence of various chemical or biological materials in the environment. More technically, a biosensor is a probe that integrates a biological component, such as a whole bacterium or a biological product (e.g., an enzyme or antibody) with an electronic component to yield a measurable signal.
Photobacterium phosphoreum
Photobacterium phosphoreum or Vibrio phosphoreum is a Gram-negative bioluminescent bacterium living in symbiosis with marine organisms. It can emit bluish-green light (490 nm) due to a chemical reaction between luciferin and molecular oxygen catalysed by an enzyme called Luciferase.
Photobacterium phosphoreum has been used because of its reliable bioluminescence to measure toxicity in aquatic environments due to biodegradable water toxins. The responsibility, simple operation, and cost performances of bioluminescence makes it a reliable reporter for assessing aquatic samples containing toxicants such as pesticides, PCBs, aromatic hydrocarbons, fuels, alkanes, alcohols, and heavy metals.
Hypothesis
Drinking water in and around Bangalore is highly
contaminated. Severe effect include arthritis, diseases of kidney, circulatory system, nervous system etc. Traditional approach for water quality testing involves standard analytical procedures Most of them are laborious and time consuming Alternative to specific chemical method is bioassay
Objectives
Isolation and culturing of photobacterium phosphoreum
Biochemical Characterization of photobacterium
phosphoreum
Comparison of bioluminescence of different water samples Analysis of luminescence values.
METHODOLOGY
The Bangada fish was brought from the local market of dwarakanagar, and use as the source
Isolation of Bioluminescent organism Enrichment Isolation Subculture
Colony characteristics Shape Margin Elevation Pigment Staining techniques Gram staining Negative staining Endospore staining Capsule staining
Biochemical characterization
Test
Indole test
Results
-Negative -positive -Negative -Negative
Catalase test
Oxidase test Sucrose utilization test
Gram -ve
Indole test
Catalase test
samples.
Sequencing Result
>KAMA GGCGGAGGGATCGGATTACTGGGCGTAAGCGCATGCAGGCGGTCTGTTAAGCAAGATGTGAAAGCCCGGG GCTCAACCTCGGAACAGCATTTTGAACTGGCAGACTAGAGTCTTGTAGAGGGGGGTAGAATTTCAGGTGT AGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGC TCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTAC TTGAAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGT CGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATG CAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAATTCGCTAGAGATAGCTTAGTGCCTTCGGGAA CTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAG CGCAACCCTTATCCTTGTTTGCCAGCACGTAATGGTGGGAACTCCAGGGAGACTGCCGGTGATAAACCGG AGGAAGGTGGGGACGACGTCAAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCGT ATACAGAGGGCTGCAAGCTAGCGATAGTGAGCGAATCCCACAAAGTACGTCGTAGTCCGGATTGGAGTCT GCAACTCGACTCCATGAAGTCGGAATCGCTAGTAATCGTGAATCAGAATGTCACGGTGAATACGTTCCCG GGCCTTGTACACACCGCCCGTCACACCATGGGAGTGGGCTGCACCAGAAGTAGATAGCTTAACCTTCGGG AGGGCGTTTACCACGGTGTGGTTCATGACTGGGGTGAGCGAG
600
y
500
Spectrometer Reading
400
x
300
200
100
8000
10000
12000
mercury
cobalt
insecticide
Summary
Effects of Heavy metals on production of
because they are complex, time consuming, expensive and require sample pretreatment
Novelty of project
REFERENCES
1.Broers, c.a.m1 and Lappalainen j, New developments in the
bioluminescence assay, Courrier du Savoir, pp. 107-110, 2004 2.Kenneth Wm. Thomulka and Lois H. Peck, Use of Bioluminescence in Detecting Biohazardous Substances in Water, Philadelphia College of Pharmacy and Science, pp.219-227 3.Attar H, Afshar S., Design of sensible biosensor for rapid detection of biocides in poble water, Asian journal of Biotechnology(2), pp. 120-126, 2010 4.Almog R.,Daniel R., Melamed S.,Belkin S., bioluminescent whole - cell biosensor for on-line water toxicity detection, Twelfth International Conference on Miniaturized Systems for Chemistry and Life Sciences, pp.597-599, 2008 5.Lojek A., Ciz M., Kubala L., The use of terrestrial bacteria with natural bioluminescence in environmental toxicology, Chem. Listy 101, pp.s116-s118,2007 6. Christine J. K., Nattapong T., Curtis A. L., Assessing wastewater metal toxicity with bacterial bioluminescence in a bench-scale wastewater treatment system, 2003
7.Lapota, D., Moskowitz, G. J., Rosenberger, D. E., and Grovhoug, J. G., The Use of Stimulable Bioluminescence from Marine Dinoflagellates as a Means of Detecting Toxicity in the Marine Environment,, Environmental Toxicology and Risk Assessment: 2nd Volume, pp. 1-15 8 . Chen A. Letz M, The Use of Dinoflagellate Bioluminescence to Characterize Cell Stimulation in Bioreactors biotechnology and bioengineering, VOL. 83, NO. 1, pp. 93-103, 2003 9. Karsi A.,Howe K.,, Wills R., Bailey R.H., Development of bioluminescent Salmonella strains for use in food safety, BMC Microbiol. 2008 10.Lloyd D., James C.J., Hastngst J.W., Oxygen Affinities of the Bioluminescence Systems of Various Species of Luminous Bacteria, Journal of General Microbiology, 131, 2137-2140, 1983 11. Water P., Lloyd D., Salt, pH and Temperature Dependencies of Growth and Bioluminescence of Three Species of Luminous Bacteria Analysed on Gradient Plates, Journal of General Microbiology, 131, pp.2865-2869, 1985 12. Yagi K., Applications of whole-cell bacterial sensors in biotechnology and environmental science, Appl Microbiol Biotechnol, 2006. 13. Eltzov E., Prilutsky E., Kushmaro A., Marks R.S., Geddes C.D., Metal-enhanced bioluminescence: An approach for monitoring biological luminescent processes, applied physics letters pp.94. 083901-1-3, 2009 .